Blastocladiella emersonii clone report

Clone ID BeCSAS2469
Best BLASTX Match gb|ABF18335.1|
Function Description major N alpha-acetyltransferase subunit [Aedes aegypti]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2469
CCTGCAGTCCGGTCCGGAATTCCGGGTCGACCCCGCGTCCGGACACCCTT
TCACTTGTTGCAACGAAACTACGGCGGCGCAGACACTATGAATATCCGCA
CGGCGACTCCCCACGACCTCCTGGCGGTGCAGAACTGCAACCTGACCAAT
CTGCCGGAGAACTACCAGATGAAGTACTACATGTACCACGCCATGTCGTG
GCCCGAGCTCAGCTTCGTGGCCGAGGACACCAAGGGCCAGATCGTCGGGT
ACGTGCTGGCCAAGATGGAGGACGCGGACGCCGAGGCCAAGACCCCCGCG
CACGGCCACATCACGTCGCTGTCGGTCATGCGCAAGTACCGCCGCCTCGG
GCTCGCCGAGCGGTTGATGAAGCAGTCGCAGATGGCCATGAAGGACGTAT
ACGAGGCCAAGTACGTGTCGCTGCACGTCCGCGTGTCCAACAACGCGGCG
CTGCGGCTGTACCAGCACACGCTGGGCTTCGAGATCATGGAAGTGGAGAA
AAAGTACTACGCGGACGGCGAGGACGCGTACTCGATGAAGTTCTTCTTCG
ACCCGTCGGC