Blastocladiella emersonii clone report

Clone ID BeCSAS2465
Best BLASTX Match ref|XP_515597.1|
Function Description PREDICTED: similar to vacuolar protein sorting 24 isoform 1; neuroendocrine differentiation factor [Pan troglodytes]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2465
CCCTCTCCCTCTCCCTGCAACCACCACAACCGCAACGTAAAGCTCATGAA
CTAAGCCATGTCGGCCTTCCTCAAGACCATGCTGGGCATCCAGTCGCCCG
AGGAGCAGGTGAAGAAGTGGCGCGGTAACCTGCGCGCGCAGGACCGGGTG
CTGGACCGGCAGATCCGGGGCATCGAGGCCGAGGAGGCCAAGGTGAAGCG
GACGCTCAAGGACGCCGCCAAGAAGGGCAACCGCGCCGCGTGCGTGTCGC
TGGCAAAAGAGCTGGTGCGGTCGCGCAAGGCCAAGGAGCGCCTGCACACG
TCCAAGGCGCAGCTCAACTCGGTCAGCATGCAGCTCGGCCAGCAGCTCGC
GGCCCTGAAAGTCGCGGGCGCGCTCCAGAAGTCGACCGAGATCATGAAGT
CCGTCAACGGGCTCGTCAAGCTGCCCGAGATCCAGGCCCAGATGCAGGAC
ATGGCCCGCGAGATGATGAAGGCGGGCATCATCGAGGAGATGATCGACGA
CACGATCACGTCGCTCGACGACGACGAGGTCGAGGAGGAGGCCGAGGAGG
AGGTCAACCGCGTTCTGTTCGAGATCACCGACGGGCTGCTCGGCCAGGGC
GGCACTGTGGGCGCCGACCTCAACCAGCCCGA