Blastocladiella emersonii clone report

Clone ID BeCSAS2464
Best BLASTX Match gb|EAQ93535.1|
Function Description hypothetical protein CHGG_01770 [Chaetomium globosum CBS 148.51]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2464
CAACGAGGAAGCACACACGACATCAACCATGGATCTCGTCAAGGTGCCCG
AACTGCTGCACCCCGTGTTCAAGCCGGTCATGAGCTACGTCGGTCTGGGC
GACGCGTGCACCGTGGAGCTGCTGTCGCCCGTGGTGGCGTGGACCAAGCC
GTGCGTGACGCTGGCCATCAGCAAGGGCCTCGGTCTCGGGATCGTGGTGA
GCGGCGCCATCGTCAAGGTGCCGCAGCTGGCCAAGATGTGGGGCCAGTGG
TCGGCCGAGGGCCTGAGCTACTCGGGGTACCTGCTCGAGTCGGTGGCGTC
GAGCATCTTTGTGGCGTACAACGCGGCGCACGCGTACCCGTTCTCGACGT
ACGGCGAGTCGGCGTTCATTGTGGCGCAGAACCTGGCGATCGTGGTCCTG
ATGGCGGCGATCCAAAAGCGCGCGGGGCTCGCGGCGGTGCTCGTCGCGGT
CTTTGCCGTTGGCGCGGCGCTGCTCGCGCAGGTGCCGATCGGCACGCTCA
AGACGCTGCAGGGCGTCACGGTGCCGCTCGGGATCGCGGCCAAGCTGCCG
CCCATCTACGCCGTGTACTCGGCCGGGTCGTCGGGCGCGCTGTCGGCCGT
CACCGTGTTCGCGTACTTTGCGGGGACCTGCGCCCGCATCTTCACCACGC
TCAAGGAGGTCGACGACACGCTGATCCTCGGGTCGTTTATCATCAACGGC
GTCCTCAACGCAGTGCTCCTCGGCCAGGTGCTCTACTACTGGAACGCGGA
CGCGGCGGCGGCCAAGAAGAAGGCTGANCAGAAGGTCGAGTAAGCGCGCG
A