Blastocladiella emersonii clone report

Clone ID BeCSAS2462
Best BLASTX Match ref|XP_759469.1|
Function Description hypothetical protein UM03322.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2462
GCGTCCGGCGTCAGCCAGTTCAGCCCACTCACGTGTCCCCTCCCATCCCT
GCCCACCCGCCCAGCCCCTGCTGCTACGAAAGCCCCGTTCACAGACCCTA
CTCGCTCCCTCCTCGACATTTGTCCAGATTTCCAAGATGGGTCGTCGTCC
GTCGCGTTGCTACCGCTACTGCAAGAACAAGCCGTACCCCAAGTCGCGGT
TCTGCCGTGGTGTCCCCGACGCCAAGATCCGGATCTACGACATGGGCCGC
AAGAAGGCCGGTGTCGAGGAGTTCCCGCTCTGCGTGCACCTGCTGTCGGA
CGAGCTGCAGCAGATCTCGTCCGAGGCGCTCGAGGCCGCCCGCGTCACGG
CTAACCGCTTCATCATCAAGCAGGCCGGCAAGGACTCGTTCCACCTGCGC
GTGCGCGTCCACCCGTGGCACGTGCTCCGCATCAACAAGATGCTGTCGTG
CGCCGGCGCCGATCGTCTCCAGACCGGTATGCGTGGTGCCTACGGTAAGC
CGTACGGTGTCGTGGCCCGCGTCGCCATTGGCCAGATCCTTTTCTCGATC
CGCACCAAGGACTCGAACAAGGCCGTCGTCATCGAGGCTCTCCGCCGCGC
CAAGTACAAGTTCCCCGGCCGCCAGAAGATCCTCGTCTCTAAGAAGTGGG
GCTTCACCAAGCTCTCGCGCGAGGCCTTCGCCGAGGGTATCCAGAACGGC
TCGGTCGTCCCCGACGGCAACGGCGTCAAGATCCACAACAACCACGGCTC
GCTCGCCAAGTACTTCAAGCGCGTCGCTGCCTAAGCGCGCCCTTCTTGGT
TGCCTTGTGTCGTCGTCCCTGCCATGAGGATAGGCGTCTCGCTCGGGCGG
GGGCGGTCCTGACGGGCCCCTTCTGTTCGGTGTTGCGGTTGTCAATATAG
CAGTGCGCGGAATTTCTTGTTAAACTCG