Blastocladiella emersonii clone report

Clone ID BeCSAS2460
Best BLASTX Match dbj|BAE60966.1|
Function Description unnamed protein product [Aspergillus oryzae]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2460
GGTGTTCATGACGGGCGTGACGCGCCTCATGAAGAACTACACCAACATGC
TGCCCGGCGCCCGCAACTCGACCATGACGTGGGACTCGTGGGCCCGCTCG
GTCCTGCCCATCGGCATCTTCTTCTCGGCCTCGCTCATGCTCAACAACTA
CGCCTACCTCTACCTCTCGGTCTCGTTCATCCAGATGCTCAAGGCCAAGA
CCCCGCTCGCCACCCTCATCCTCTCGTCCATGTTCGGCCTGCAGAAGATC
AACAACCAGCTGCTCGTCAACATCTGCGGCGTCGTCGTCGGCGTCATCAT
CGCGTCCTACGGCGAGATCATGTTCGACCTGACGGGCTTCATCTTCCAGG
AGCTCGGCATCGTCTTCGAGTCGGCCCGCCTCGTCCTCATGCAGAAGCTC
ATGACCGAGAAGCTCGACCCGCTCTCGACGCTCTACTTCTTCGCCCCGGT
CTGCGCCATCCTCAACGGCTTCTCGTTCCTCATCTTCGAGTACGGCCACA
TGGAGGACGGCATCCTCGCCGCCGTGTCGGAGCTCGGCGCCGGCATCTTC
CTGTCCAACGCCATGGCCGCCTTCGCCCTCAACATGGCCCTCGTCCTGCT
CATCGGGTGCACCAGCTCGCTCGTCCTGACGCTGTGCGGCGTGCTCAAGG
ACATCCTGCTCATCGCCCTGTCCATGATGATGTTCGGGTCCAAGACGTCG
GGCGTCCAGGTCTTCGGCTACTCGCTCGCCCTCCTCTTCCTCACCCGCTA
CAAGACCATGAACACGGACTGGCGCAAGGAGTACCGCCGCCTCACGGGCC
TCGACCAGCAGGACCGCGACCGGCCGCTGCCCCGCTAAGTCATTCCCGCT
CATCTGTAATGGCACATCATCCCCCCTCCCCTCTTTTGTTATTATTCGAA
TCACTGCACACTAAAGTTATTACTA