Blastocladiella emersonii clone report

Clone ID BeCSAS2459
Best BLASTX Match ref|XP_683479.1|
Function Description PREDICTED: similar to proteasome 26S non-ATPase subunit 8 [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2459
GTCGCCTCCTCCGCCCGCCCCGATCGTCCCCCTCGCTCGCTTCGATCTCG
ACGTCGCCATGAGTTCCACCGCCAACCCCGCTGCCCTCGCCAACGCCGCC
AAGGCGTACGAGCAGCTCAAGGCCGCCTTCTTCGCGCCCAAGCCCGACCT
CGCCCAGTGCGCCGCCCACCTGACCCAGGCCAAGCTCGCCCTGGCCCAGC
TCGGCACCTTCCTCGTCGCCGACCCGTCCAAGCCCTCGGCCCAGCAGGAG
ATGGTGCTCGCCCGCGACACGCTCGAGCTCGCCGCCCTGCTCAGCATCCG
CCAGGGCGACATTGTCGCCTTCGAGCGCCACTACGCCCAGCTCGCCACCT
ACTACATTGACTACGCCGCCGTGCTCGCCGAGTCGCCGCGCCACCTCATG
CTGCGCGGCCTGCACCTGCTGTCGCTGCTCGCCCAGAACCGCATTGCCGA
GTTCCACGCCGCCCTCGAGCTGATCCCGCCCCAGCACCACCTCGGCAACG
TGTACATCCGCCACGCCGTGCACCTCGAGCAGGCCCTCATGGAGGGCGCC
TACAACAAGGTGTGGCACGCGCGCGGCGACGTGCCGGCCGAGGAGGCCCT
CTTCTTCATCGACATGCTCGTCGGCACCATCCGCGACGAGATCGCCTCGT
GTGCCGAGCGCTCGTACCCGTCGCTCCCGCTCAAGGACGTGGCCACGCTG
CTCTTCTTCCCCGCCGGCGCCTCGCAGGCCAGCGACGTGCTCGCCTTCTG
CAAGGCCCGCACCTGGGACGTGAACGCCGCCGACGGGTCCGTCCGCTTCG
CCGGCAACGAGCAGACCGAGTCCGCCCTCGACGCCCACATGGTCATGCAC
AACGTCCTCGGCTATGCCCGCGAGCTCGAGCGGATCGTCTAGGCGGTTTT
TGTTTTGGTGGATGACGCGCGTGTCTTGCACAGATTTGAACAGTTTTCTT
TCTC