Blastocladiella emersonii clone report

Clone ID BeCSAS2455
Best BLASTX Match ref|XP_687522.1|
Function Description PREDICTED: similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase-2) isoform 1 [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2455
GCACGGCGCCCGCATCGTGTCGACGGTGCTCAACACGCCTGAGCTCAACG
AGGAGTGGCTCGGCGAGGTCAAGACCATGGCCGACCGCATCATCACCATG
CGCGAGCGCCTCTTCAACCACCTCGTCGACGACTTCAACTCCAAGCTCGA
CTGGTCGCACATCACGTCGCAGATCGGCATGTTCTGCTTCACGGGCCTGC
GCCCCGAGGAGGTCGACCGCCTCAAGTCCGAGTTCGCCGTCTACCTCACC
CGCGACGGCCGTATCTCCATTGCCGGTATCTCGTCGGGCAACGTCGAGTA
CCTCGCCAAGGCCATCCACGAGGTGACCAAGGACCGCGCCTAAGCGCCTT
CCCCCTCTCCCCTTCCCATCTGTGAATACCTCCTCCCCTCTCTCTCATCG
CGCGTGTTGGTGCGCTGCGCGCACTCACCCCCTTCTCCTCCTCGTCGCAT
GATATAGCCATGTCTCCGCTTTTGGATATCTTGGTCGCGTCGTTGCGTTC
CGAGAGCGGGAACCGGGCAGTGTGCGCGTGCGGCTTCGCGTCCCTCTCTT
TTCCCTACCTCACCCCCCACCCGCCCTGAATGTCGAATATCGGAACGTCA
AGCTCGAAGAATGAAGAATCAATACACCCAAACTATTGCTAGTG