Blastocladiella emersonii clone report

Clone ID BeCSAS2453
Best BLASTX Match ref|XP_504174.1|
Function Description hypothetical protein [Yarrowia lipolytica]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2453
CTCGGATGACTGAGATCCCGATGAACCCTTGTCCCTTGGGGGTCGCGGCT
CAGCGCGTATAAAGAGCGGCCGTCTCCCGCGTTCCCATCGGCGACAGCCC
TCACGCATCGTCATCTGCTACGCATCGAACGAACGAACGAATTCCCTTCG
GCTCCGCGCTCATCACACGTGGTGTCTGGACCGATCCATTCTTGCTGCTG
ACAAACCCGCCGCGAGGACCATCTCTTTGCCACTCAGTTCCGCGCCGCTG
CCGCATCGACCACCACTGCCGCCGCTACCGCTACCGCCATGACCCCCGAG
CCCTCGACCACCACTTCCCCCGCGACGACCGAGTTCGCGACGCTCGCCGC
CGGCTGCTTCTGGGGCGTCGAGCACCTGTACCTCAAGCACTACCGGACCA
AGGGCATCGTGAGCACGGCCGTCGGGTACGCGCAGGGCGCGTCCGCGAAC
CCGACGTACAAGCAGGTGTGCTCGGGGACCACCAACCACGCCGAGGTGCT
GCGCGTCGAGTTCGACCCGGCCAAGGTGAGCTACGAGGAGCTTGTCACTT
TCTTCTTCCGCATCCACGACCCGACCACCGTCAACCGCCAGGGTCCCGAC
GTCGGCACCCAGTACCGCTCGGGCATCTACACCGAGAACGACGCGCAGCG
CCAGGTCGCCGAGGCCGTCAAGGCCAAGGTCCAGAAGTACTTCAACGCGC
CCATCGCCACCGAGATCCAGCCCCTCACGACGTTCTGGCCCGCCGAGGAG
TACCACCAGAAGTACCTCATCAAGAACCCCTCGGGCTACGAGTGCCCCGC
GCACTTTGTGCGCGAGTTCCGCGATTGAACGCGGTCGGCTGTGATATCCC
CCGCGTGCGCGAGCGCGCGTATGAATAAATCGTCCCTTGTATAGTC