Blastocladiella emersonii clone report

Clone ID BeCSAS2450
Best BLASTX Match ref|ZP_01112423.1|
Function Description zinc-containing alcohol dehydrogenase family protein [Alteromonas macleodii \'Deep ecotype\']



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2450
ACGCGTCCGGATCGGCCACCTCCTCTCGCTCCTTGCAACGTATCACTTCC
ACCAACAATGTCGCCGCCCAAGACCGCCTCGCCCATCAAGTCGCCCGCCA
AGGCCTCGCCCGTCACGGTGACGGCGGGCCCGCGCAAGATCACCGGCTAC
GCGGCCAAGTCGCGCGGCGCGGCGCTCGAGAAGTGGACGTACGAGGCGCC
GGCGCTCGGGCCCAACGACGTCGACATTGTCGTCGAGTGCTGCGGCGTGT
GCCACTCGGACATCCACACGCTCGACGAGGGGTGGGGCGCCACCGAGTTC
CCCGTGATTGTCGGCCACGAGGTTGTCGGTACGGCGATCGCGCTTTAGGG
GAGTGGGAGAGCTCTGCGGCGGCTAACGCGATTTGTTCCCTGCAGGCAAG
GTCGCGGCCATCGGGTCGAACGTCACGCACCTCAAGATCGGCGACCGCGT
GGGCGTCGGGGCGCAGTGCGGGTCGTGCAGCCGGTGCAGCCCGTGCCTGC
ACGGCAAGGACAACGTGTGCGCGAACGGCGTCTTCACGTACAACAGCACG
CACCCGA