Blastocladiella emersonii clone report

Clone ID BeCSAS2449
Best BLASTX Match ref|XP_790088.1|
Function Description PREDICTED: similar to ATP binding protein associated with cell differentiation [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2449
CGATCCTCACCATGGCCGAACCAAGCGACCGCGTGCTCGACCACCTCGAC
TCGGACGACGAGCTGTTCGACGAGCTGGAGCGCGAGGCCGACCAGTTCAC
GGGCTTCCGCGAGCAGCGCCTCGAGCAGCTCAAGTACGAGCTGGAGCGCG
CCCGCGACATGAAGGAGAACCACCACGGCACCTACATCGAGATCAAGGAC
GAGAAGGACATTCTCAAGCTGACCACCACCACGCCGCGCGCCGTCGTGCA
CTTCTTCCACAAGGACTTCCGTCGCTGCGCCATCATCGACAAGCACCTCG
AGATCCTTGCCCGCAAGCACTTCAAGACCCGCTTCGTGCGCGCCGACGTC
GAGAACGTGCCGTTCCTCGTCGACCGCCTCAAGGTCAAGGTCCTGCCGTG
TGTCATCTTCTTTGTCGACGGCGTGAGCAAGGACCGCCTCATCGGCTTCG
AGGAGCTCGGCAACACCGACAACTTCACCACCGACATGCTCGAGAAGCGC
CTGTACAAGGCCGACGTCATCGTGCGCCCCTCGGAT