Blastocladiella emersonii clone report

Clone ID BeCSAS2445
Best BLASTX Match emb|CAJ17183.1|
Function Description ribosomal protein S11e [Eucinetus sp. APV-2005]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2445
CCGGGTCGACCCCACGCGTCCGCGAACGGTTGAACCAACAGACACCATGG
CTGATATCCAGACCGAGAAGGCTTTCCAGAAGCAGCACATCTTCCTGAAC
GCCAAGCAGGTTGGCGCCAAGAAGCGTGCCCAGCGCTGGTACAAGGAGGT
CGGTCTCGGCTTCAAGACCCCCAAGGAGGCCATTGAGGGCAACTACATCG
ACAAGAAGTGCCCCTTCACCGGCAACGTCTCGATCCGTGGCCGCATCCTC
ACCGGCACCATCGTCTCGACCAAGATGAAGCGCACCATCATCATCCGTCG
TGAGTACCTCCACTACGTGAAGAAGTACAACCGTTACGAGAAGCGCCACC
GCAACCTCGCCGCCCACATGTCGCCCTGCTTCATCGGCGTCGAGAACGGC
GACGTTGCCACCGTCGGCCAGTGCCGCCCCCTCTCGAAGACCGTCCGCTT
CAACGTGCTCAAGATCCAGAAGGCTATCTCGGGCTCGAAGCAGTTCAAGA
AGTTCTAAGGTGGCCGGCTGTGCTGGTGGTGGTCGAGTCCCGGCGCTCCT
CTCCGGAGCCTGTTCCTCCCTCCTTCCTCCCTGCCCCCCTCGTCTTCGCG
GATAATTCGATCTTGTCGTTATGCATGCTTTTTTGGAAACC