Blastocladiella emersonii clone report

Clone ID BeCSAS2443
Best BLASTX Match emb|CAA19033.1|
Function Description rps3 [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2443
TCAAGGACGATTATCAACATGGCCACCATCTCGAAGAAGCGCAAGGTGAG
CACGCCGCCGTCCCATGCATCTCCATGAAATTTCGTCAGGAAAGAGGCAG
AAAATGCTGACTCGCCGCCACCCCTTGCCACGCGCACCCATCCGCCGCGA
TTCCCCCGTAGTTCGTCGCCGACGGTGTGTTCTACGCCGAGCTCAACGAG
TTCCTGCAGCGCGAGCTGTCCGAGGACGGCTACGCCGGCGTCGAGGTCCG
CGTGACCCCCGCCCGCACCGAGATCATCATCCGCGCCACCTCGACCATGT
CGATCGTCGGCCAGCGCGGTCGCCGCATCAACGAGCTCACCTCGCTCGTC
CAGAAGCGTTTCGGCTTCGCTGACGGCGCCGTCGAGCTCTACGCCGAGCG
CGTCCACGAGCGCGGACTCTGCGCCATTGCCCAGGCCGAGTCGCTCAAGT
ACAAGCTCCTCGAGGGTCTGGCCGTCCGCCGCGCCGCCTACGGTGTCATG
CGCCAGGTCATGACCCACGGCGCCAAGGGTTGCGAGGTTGTCATCTCGGG
CAAGCTCCGTGCCGCTCGCGCCAAGTCGATGAAGTTCACCGACGGCTTCA
TGCTCCACTCGGGCCAGCCCGCCAAGGACTACATTGACCAGGCCGTCCGC
CACGTCATGCTCCGCCAGGGTGTCCTCGGCATCAAGGTCAAGATCATGCT
CGAC