Blastocladiella emersonii clone report

Clone ID BeCSAS2442
Best BLASTX Match gb|AAZ73764.1|
Function Description 20S proteasome beta subunit [Cirrhinus molitorella]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2442
AGGAACCTGCTACGCATCTACGAATCAACACCATGCTCGCCGACGCCCCG
GCCGCCACCCACCACGCCGCCGCCATGCAGCGCCGCGTCGACCCCTACGC
CGACAACGGCGGCACGGCCGTCGCCATCGCCGGCGAGGACTACGCCATCA
TCGCCGCCGACACGCGCCAGTCCGAGGGCTACAACATCAACTCGCGCAAC
GCGCCCAAGGCCTTTCAGCTCAACGAGTCGACGGTCGTCTCGTGCTGCGG
CTTCTACGCGGACGCGACGGCGCTGACGACGTACCTGAAGCAGCGCATCG
TGCAGTACGAGTTCGACCACGACAAGCCCATGTCGACGCCGGCGCTCGCG
CAGCTGCTGTCCATCACGCTGTACGGCAAGCGCTTCTTCCCGTACTACGT
GCACAACATCCTGGCGGGGCTCGACGAGGAGGGCCGCGGGTGCATCTTCA
ACTACGACCCGGTCGGGTCGTTCGAAAAGTACCGGTGGCAGGCCGCCGGG
TCGGGCGTGTCCCTGATCCAGCCGTTCCTCGACAACCAGGTCGGGTTCAA
GAACATGCCGCTGGAAAAGAACCCGCCGTTCCTGCCCCTCGCCAAGGCCC
TCCAGCTCGTCAAGGACGCCTTCACCTCGGCCACCGAGCGCGACATTTAC
ACGGGCGACTGCGTCGAGATCTTTATCATCACCAAGGACGGCGTGCGCAA
GGAGTCGTACGACCTCAAGAAGGATTAAGTGAGTTTGTCGTTGTCAGTAT
ATTCGTTCGTTTGTTGTTCTGAAAAA