Blastocladiella emersonii clone report

Clone ID BeCSAS2438
Best BLASTX Match ref|XP_527015.1|
Function Description PREDICTED: similar to cation channel, sperm associated 3; calcium channel repeat containing 1; one-repeat calcium channel-like gene; putative ion channel CatSper3 [Pan troglodytes]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2438
CTGCACACATGAAACACGAATGAAACGTATCTAAACTCCCTGCAACAAAC
ACACCACCACTATGGTCAACGGCAACTCGGTCGCGTTTGGCGGGTGGGGC
ATCAACAAGGCGTCGACGCGGGGCGTTCGGCTGCTGCAGGAGTTTGCGGC
GAACGGTCTACCGACGGACCGAACAGACGAAGTCGCGCCCGACGCGCCGG
ACGCGCTCGCGCTGCTGGCCGAAGAGCGCGCGCGGATCCAGTCCGAGGAG
CTACACCGTCAGCGCGTGTTCGTTTCGCGGATCGTCAACTCGTCGCTGTT
CTCGCGGCTGATGCTGCTGACGATTTTCGCCAACTGCGTCACGATCGGGA
TCGACACGTCGTTACCGGACGACCAGACGCTGTTCTCGCAGTACACGGAC
CTGCTGTTCCTCGGCATCTACACGGTCGAGTTTGTGCTGAAAATCTTTGT
CGAGCCGCGCGGGTACTGGCGGTCCGGGTACAACAAGTTCGATTTCATGA
TCCTGGCCATTTCGATTGCGCAGTTTGTCATCTCGCTGCTGGGCGCGTCG
CTCGGCAACCTGACGTTCCTGCGCGTGTTCCGGTCGCTGCGCGCGCTGCG
GTCATTCCGGTCCATTTCGTCGGTCCGCCGGCTGCAGATCATCGTCAACG
CGCTGCTCCTGACGCTGCGCAAGTCGGTGCTCGACATTGTCGCGGTCCTG
TTCGCCTTCACGTTCATCTTCGCCGTCATGGGGTACTACCTGTTCGGGTC
CGACAACAAGGCCGACGCCGACGACTTTGGGACGCTGGGCGCGTCGCTGC
TCAGCCTCATGTACTACATCACGAGCTCCGGGTGGGTGTCGGTGCAGACG
AACCTGACGGCCAAGGGGTACGCGGGGTCGGAGCTGTACTCGATCCTGTT
CATGGTGATCAGCAACTTCATCTTCACCAACATGTTCATCGGCGTCATCT
GCGAGAACATCGAGGAGGCGAGCGAGGCGGACCGGGCCAACCAGCTGCGG
ATCCGGCTCGACGCGCAGCGCGAGAAGAAGGAGGCGTTCCGCGACAAGCA
GCGCAACGACATGCGCGAGCTGCTGGCCCGCACCGACCTGTCGAGCAACC
AGAACATGCAGAAGATCCTCGAGTCGCTCGCGGGCACGCTGCGCCACGAC
GAGGTGGTGCCCATGACCCACCTCGCGTGCAACCTGACGTGGTTCGAGGC
GTTCATG