Blastocladiella emersonii clone report

Clone ID BeCSAS2437
Best BLASTX Match dbj|BAD01553.1|
Function Description FK506 binding protein [Malassezia pachydermatis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2437
GCTCGTTCGTTCACCAACTCTGCTATCAACATGGGCGTTACCAAGGAGAC
CCTCAAGGCCGGCGACGGTGTCAACTTCCCCAAGAAGGGCGACAACTGCA
CCATGCACTACATCGGAACTCTGGCCGGTGACGGCAAGAAGTTCGACTCG
TCGCGCGACCGCGGCCAGCCCTTCCAGACGGCCATCGGCGTCGGCCGCGT
CATCCGCGGCTGGGACGAGGGTGTCCCCCAGATGTCGGTTGGCGAGGTTG
CCCGCCTCACCATCACCGGCGACTACGCGTACGGCCCCCGCGGTGTCCCC
GGCCTCATCCCCCCCAACGCCACGCTCGTGTTCGAGGTCGAGCTCCTCAA
GATCAACTAAGGTGTCCACGCGTGCGCGTGCGCGCTGGCGCAGTGTACAT
GATCATCAATGGCATTCGTTCTCTGTGTGTCCGT