Blastocladiella emersonii clone report

Clone ID BeCSAS2436
Best BLASTX Match dbj|BAA33715.1|
Function Description aminopeptidase N [Bombyx mori]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2436
CTCAGCTTCCCCGACCTCAACGTCACGCGCATCGTCCAGGAGTGGATCCA
GACGCCGGGCTACCCGCGCGTGACCTTCTCGCTGCCCGAATCGACCTCCG
CTGGCAAGCCCGTGGTCCCCGGCCGCGGTCCGGTCCCCGCGTCGCTCGCC
GTCGAGCAGACGCGCAACTCGGGGATCCGCGTCAACGCGTCGGAGCCGAC
CAACCCGCTCGGCACCGTGTGGCAGATCCCGCTGACGTGGGCCGTGTACA
CGAACCGCACGGGCGTGCCCGTGGCGACGGGCGCCGCGCAGTCGACCGTG
TTCGACGCGGCCAAGGGCGCGATCCAGCTCACGACGCCGCCCGCGCGCGA
CCTGCCCGTGTTCGACGAGCACTGGGTCATCAAGCCCAACGTCGGCCAGC
ACGGGTTCTACCGGTTCGTGATCCCGAGCCCGATGCTGCACACGGTCGCC
GAGTGGTGGACGGCCAACCCGCAGCTGTGGACGCCGCTCGACCGCGCGGG
CGTGCTCGAGGACGCGCTCGACCGCCTGATGGCGGGCGACGCCGACGTCG
ACGCGGCGCTCGGCCTCCTGCGCGGCCTGTACCGCGAGCAGACGTACACG
GTGTGGGGCGTCGCCATGGACCGCCTCGCGTCGATCCGCCGCCTGCTCGA
GCTGC