Blastocladiella emersonii clone report

Clone ID BeCSAS2434
Best BLASTX Match emb|CAI44947.1|
Function Description putative HSP100 protein [Phycomyces blakesleeanus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2434
GCGTCCGACCAGGACCAGTTCACCGACAAGACGTCCAAGGTGCTCCAGCG
CGCGACCGAGATTGCGCGCGAGTGGGAGCACGTCCAGCTGCACCCGGCGC
ACATGTCGGCGGCGCTTCTCGACGACGAGGACGGCTTCACGCGCAACGTG
ATCACCAAGGCCGGCGGCGACCCGCTCGTCGTTGAGCGCGTCATCAAGCG
CGCCATGGCCAAGCTGCCCGCGCAGTCGCCGCCGCCCGAGCAGCTATCGC
TGAGCCCCGCCGGCCTCAAGGTGCTCAAGGCCGCCCAGGACCTGCAGAAG
ACGCAAAAGGACTCGCACACGGCCGTCGACCACGTGCTCGCCGCCCTGCT
CGCCACCCCCGAGTGGGAGGCGGCCCTGCGCGAGGCCAACCTGTCGCGCA
AGGCCGTCGAGATCGCCATTGCCGGCGTGCGCGGCAACCGCCGCGTCGAG
TCCAAGTCGGACGATGAGAACTACGAGGCGCTCGCCAAGTACGCGATCGA
CCTGACGGCGCTCGCCGAGGAGGGCAAGCTCGACCCCGTGATTGGCCGCG
ACGACGAGATCCGCCGGTGCATCCAGATCCTGTCGCGCCGCGGCAAGTCC
AACGTGTGCATCGTCGCGTTCCCCGGCGTCGGCAAGACGGCGCTCGCCGA
GGGCCTCGCCCAGCGCATCGTGCGCCGCGACGTGCCCACCAACCTGCAGT
GCCGCCTCTACTCGCTCGACATGGGCGCGCTGATTGCCGGCGCAAAGTAC
CGCGGCGAGTTCGAGGAGCGCCTCAAGGCCGTGCTCAAGGAGATCAAGGA
CAGCGACGGCCAGATCATCCTGTTCATCGACGAGATCCACACGGTGCTCG
GCGCCGGCGCCACCAGCGGGTCCATGGACGCGGCCAACCTGCTCAAGCCC
ATGCTCGCGCGCGGCGAGCTGCGGTGCATCGGC