Blastocladiella emersonii clone report

Clone ID BeCSAS2433
Best BLASTX Match gb|AAH74341.1|
Function Description MGC84177 protein [Xenopus laevis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2433
CCAAAGTCTTGCCTTGGGCAACCACGTAGCTTACCTGTCAGCCAGTCTGT
CGCCGCGGCCTGATCTCTACCTCTACCAGCCATGAGCACCAACACCGAGA
GCCGCCCCGCGTCGCCGTTCGTCGACCCCGAGAACGGCGCCATCTACGCG
TCGGGCCGCAAGCCGACGGACCTGGTGCGCGGGCCCGACGGCGCGCTGCG
CAAGCCCGTGGTGATCTGGGTCGACGGGTGCTTCGACATGATGCACTACG
GGCACGCCAACGCGCTGCGCCAGGCAAAGTCCATGGGCGACCTGCTCGTC
GTCGGCGTGCACAGCGACGCCGAGATCCAGCACCACAAGGGCCCGACGGT
CATGCGCGAGGAGGAGCGGTACCAGGCGGTGGCCGCGTGCAAGTGGGTCG
ACGTGGTGGTCCCGAACGCGCCCTACTTCACGCAGCTCGACTGGCTCGAC
CGCTTCCACTGCGACTTCTGCGTGCACGGCGACGACATCACCACGCTCGC
CGACGGCACCGACTGCTACCAGGAGGTCAAGGACGCCAACCGGTACCGCG
AGTGCAAGCGCACCCAGGGCGTCTCCACCACCGAGATGGTCGGCCGCATG
CTGCTCATGACCAAGGACCACCACAAGCGCCGCAGCAGCGTCGCCCAGTC
GTCCATCACCCACTTCAAGTCCGAGGAGCTC