Blastocladiella emersonii clone report

Clone ID BeCSAS2429
Best BLASTX Match ref|XP_597436.2|
Function Description PREDICTED: similar to CG16940-PA, isoform A [Bos taurus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2429
GGTCCGATTCCCGGGTCGACCCCGCGTCCGATCGACGAGTGGCCCGCCGA
CAACCAGTTCCCGCTCGCCAGCGTCACGGCGACCGTCGGCCAGGCTGGCA
CCATGGAGGCCGAGACCAAGGCCCTGCTCATCGGCAACGCCGTCAACCTC
GACCCCTTCGACGAGGCGTGCCTCGCATCGCTGCCCGAGACGCCCTGGTC
CATTTCCGACGAGGAGCGCGCACGGCGCTGGGACTTCACGGGCAAGAACA
TCTTCACCATCGACCCGCGCACCGCCAAGGATCTCGATGACGCGGTCCAC
ATTGAGCCCGTCCCCGACATGCCCGGCGTCTACGAGCTCGGCGTCCACAT
TGCCGACGTCAGCCACTTCCTCGAGCCCGACACGGCGCTCGACGTTCGCG
CTTCGACGACGTGCACCACCGTCTACCTCGTCGACCGCGCCATTCCGATG
CTGCCCAACCTCCTGTGCGAGGAGCTGTGCTCGCTTAACCCGGCCGTCGA
GCGGCTCGCCTTCTCGGTCGTGTGGCGCATCCGCCTCGAGGACGCCGAGA
TCCTCGACACCAAGTTCGGCAAGTCGGTGATCCGGTCGCGCGCCAAGCTC
GCGTACGAGGACGCGCAGGACGTGATCGAGGGGTACCCGCTGCCGACGCG
CGACGTGCTGCTCGCCGACGACGCGGACGAGGCCACCATGACCGAGTCGA
TCAAGCTCCTGTACAAGCTGTCGCGCGTGATTCGCCGGCAGCGGTTCGAC
AACGGCGCGCTGACCATGAGCACGGTCAAGCTCGCGTTCGTGCTCGACCC
CGTGTCGCAGATGCCCGTCGGGTGCAAGGCGTACGAGATCCGCGAGGCGA
ACCAGCTCATCGAGGAGTTCATGCTGCTCGCCAACCGCAGCGTCGCGCAC
AAGATCCACTCGGCGTTCCCCGACCTCGCCCTGCTGCGCAAGCACGAACC
GCCGGGGTCCGGGCCGATGC