Blastocladiella emersonii clone report

Clone ID BeCSAS2428
Best BLASTX Match ref|XP_752613.1|
Function Description hypothetical protein Afu1g12440 [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2428
CCTGCAGTCCGGTCGGATTCCCGGGTCGACCACGCGTCCGCTCCCGAGGC
ACCCACACACAACAAAATGACCGCCAACACCATCGCCCTCATCGGCCACC
GCGGCCTCGCCGGCAAACCCATCGTCGAGGCCCTCGCCGCGTCGTCCGCC
CACCCCAAGGTCAAGGTCCTGCACCGCCCCGGCTCGGACGCCTCGGGCCT
GCCCGCCAACGTCGAGGCCGTCGAGGTCGATTTCGCCGACACGGCCGCCC
TCACCAAGGCGCTCGCGGGCGTCGACATTCTGCTGTCCACGGTCGGCGCG
CCGGGCATCGCCGCGCAGATCGACCTGATCCCCGCCATCAAGGCCGCCGG
CGTCAAGCTGTTCGTGCCGTCGGACCTCGCCGTGCTGTACACGCCGCACG
AGCGCCGCGCGTTCGGGCTGCTCGAAGAGAAGGGGCGCGTCGATGAGGCC
CTCAGGGCTGCAGGGGTCCCGTTCGCGGTGGTGCTGACGGGCGGGTTCAC
CGAGTACTGCCTCGCGACGCCGTTCATCGGCATCGACGTCAAGGGCAACA
AGCTGCACCTCGTGGGCGACGACGCGCGCACGCACTCGGTCGCGCTCAGC
TCGACGGCGTACATTGCCGCGGCGTACGCATCGCTGTTCGCGGCGACGCC
CGCGGCCGAGCTGGCGGGCCGCGCCATTGGCGTGAGCGAGGTCGTGGCCA
ATGGCGACCAGATC