Blastocladiella emersonii clone report

Clone ID BeCSAS2427
Best BLASTX Match gb|AAW46181.1|
Function Description large subunit ribosomal protein L3, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2427
GCGTCCGAGCACGGATATTTACAATGTCCCACCGCAAGTTCGAGCACCCC
CGTCACGGTTCGCTGGGTTTCCTGCCCCGCAAGCGCTGCCGCCATCACCG
CGGTAAGGTCAAGTCGTTCCCCCGCGACGATGCCAAGAAGCCCGTGCACC
TCACGGCCTTCATCGGCTACAAGGCCGGCATGACCCACATTGTGCGCGAC
CTCGACCGCCCCGCGTCGAAGATGCACAAGAAGGAGATCGTCGAGGCCGT
GACCATCATCGAGACGCCCCCTATGGTCGTCGTCGGTGTTGTCGGCTACG
TCGAGACCCCCCGCGGCCTGCGCACCCTCACCACGGTGTGGGCCGAGCAC
CTCTCGGAGGAGGTCAAGCGCCGCTTCTACAAGAACTGGTACAAGTCCAA
GAAGAAGGCCTTCACCAAGTACGCCGGCAAGTACGCCGAGGGCGCCAAGG
ACATCACCCGCGAGCTCGAGCGCATCAAGAAGTACTGCCAGGTTGTCCGC
GTCCTCGCGCACACGCAGATCCGCAAGGTCAAGATCGGCCAGAAGAAGGC
GCACCTCATGGAGATCCAGCTCAACGGCGGCTCGATTGCGCAGAAGGTCG
ACTGGGCCAAGGAGCACTTCGAGAAGGAGGTCGACATCAAGTCGGTCTTC
GAGCAGGACGAGAACATCGACATCATCGGTGTGACCAAGGGTCACGGTTA
CGAGGGTGTCACCCACCGTTGGGGCACCAAGAAGCTCCCCCGCAAGACGC
ACCGTGGTCTCCGCAAGATTGCCTGTGTCGGTGCCTGGCACCCGTCGCGC
GTCATGTACTCGGTGCCGCGCGCTGGTCAGAACGGCTACCACCACCGTAC
CGAGATCAACAAGAAGATCTACCGCGTCTCGAACGGCCAGGCCTCGGCCT
CGGGCTCGACCGAGTTCGACATCACCGAGAAGACCATCAACCCCATGGGC
GGCTTCCCGCACTACGGTATGGTCAACGAGGACTTCCTCATGATCAAGGG
CTGCTGCGTCGGCACCCGCAAGCGCATCGTCACCCTGCGCAAGACCATGG
TTACCCACACCTCGCGCGCCTCGCTCGAGAAGGTGTCGCTTAAGTTCATC
GACACCTCGTCCAAGTTCGGCCACGGTCGCTTCCAGACCGCCGACGAGAA
GAAGACCTTCATGGGTACCCTCAAGAAGGACCTGTAAGTTGTCGTCTCTC
CTCCCTCGACCGCTCTGTGACGCTGGCGCGCGTTCTCGGGCAGCGCTTGT
TGTCCACGGAATACACACTAGTTCACACAACACAAACCAAACGTGCCGGA
CAGAGCCGGCAAAGCCATCACGTTCAGAGACCAAAAACGACGTGGAGCTA
GACCAAAAAGATCGAAGCGCTGATCGGCAAAAAAGCTCGAGGCGTTCCCC
ATCGACAAGGAGGCGGTGCTGCTCCTCACGGAGCGCGTCGACGGAGGCGT
GCCGCCTCGCGGCACAGCATATGCGCGAGGAGGCCAAGGCCGCGCAGCAT
GGCGCCAAGCACGGCAAGAAGCGCAAGCAGGACGCCGACGACACCGAGGA
GGCCTCGGAGCGGATCCGCGGCACCAAAGACAAGTACAGCCACCTCCGCC
ACAATAATAAGCAGAAGAACTGAAGCCATACATGTACCATACGATTAATT
TATCCCAAGTAGTGTTCACCCATTCACTTGGTCTTT