Blastocladiella emersonii clone report

Clone ID BeCSAS2426
Best BLASTX Match gb|AAT87227.1|
Function Description Polysaccharide deacetylase family protein [Streptococcus pyogenes MGAS10394]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2426
GGATCACGCACACGCACGCAAGGAATGACGCGCCAACTGCCCCTTCTCGC
GCTGCTCGCGCTCCTGGCCGCCGTCGCGCCGGCGCGCGCCCAGCTCCTCG
ACGACTTCAGCAAGACGTCGTTCACGTCCAACGCCCTCAACTCGCTCGGC
GTCTGGCACGGCGGCAGCGGCGTCACGGGCGTCACGGGCGGCGTGGCGAT
CGCGTCGGGCGGCTTCTTCGAGGAGCTCGTCAACTGCAAGGACATGCGTG
GCACCTCGGTCGTCTTCGAGTACACGCCGAGCTCGGTCAACCAGAACATC
GTGTTCGAGTACTTTGAGGGCTGCCAGTCCGAGGGTGCCGGCCACGCCGT
CACGATCAAGGGCCCCGCGACCAAGACGCGCGCCACGGCGACCGTGCCCA
TGGCCACGTTCGGGACCAACGTGCAGTCGGTCAACGGTATCCAATGGAAC
GGCCCGCTCACGATCCACAAGGTCAGCATCGCGACCGGCACGGCCACGGC
CACGGCCACCTCGACGGCGACGTCCACCACGACCAAGGCCACCACCACCA
CGACCACCACGTCGACGTCGACGTCGACCTCTACTACGGTCAAGCCGACC
ACCACCACTACGACCAGCTCGACGACCACGACGGCTCCGCCCGCGTCGAC
CTTCTGCATCACCGAGGCCACGGACGGCACGTGCGGCGGCAAGAAGGTGT
GCCCCGGCGGCCAGTGCTGCTCGCAGTACGGCTGGTGCGGCACCACGTCC
GAGTACTGTGGGACCGGGTGCCAGAGCCAGTGCAACCTGGTCGCGGTCGC
CGGCGTCAAGCCGTGCAACGCCGTGTCCTCTTCGACTACTGCCACCACGG
CGACGTCGAGCGTCCCGACCTCGACCGCCACGGGCACGATCCCCGCGGTC
CCCGCTAGCCCAACCCTGTGGACCGTCTCGCCGTCCCTCACCAACGGCCA
GTTCTCCAAGGACAGCTTCGGCATGTACACGAGCTGCGGGTGGTCGCGCA
TGTTCGCCCTCACCTACGACGACGGACCGCACCCGACCCTGACCAGCCAG
ATCCTCTCGAACCTCGCGGCGGCGTCGTACAAGGTCACCTTCTTCTGGAT
CGGCCAGAACGTGCGCGACAACCCCACGATTGCGCAGCAGGTGATCAACG
CGGGCCATCACGTAGCTCATCATAGTTGGTCTCACGCCGACTTTGCCACG
CTTTCGGCGGCCGATCTCAAGTCGGAGCTCGACCAGACCATCTCGGTCAT
CTCGCCGTACATCGGCGGCAAGAAGCCGCGCTACTTCCGCCCGCCGTACG
GCTCGATGAACGCCGCCGTCATGGCCACGCTGACGGCCGCGCCGTACAAC
TTCCGCGTGATCCTGTGGGACCTCGACTCGAACGACTGGAAGACCGACGC
CGAGAACCCGCCGTCGGCCATTCTCTCGTACTACCAGACCGAGCTCAACC
GCACGCCGGCGTCGTCGATCAGCCACATTGCCCTCAACCACGACATCCAG
CAGAAGGCCGTGACCGTCGCGCCGACGCTGTACCCCATGATCAAGTCGGC
CGGGTTCACGGTTGTCCCGATGTTCATGTGCCACAACACTGAGGCGTACG
CTTAGGCATAGTTTATTCCCGCGTCGTCGTGGGCGGCTTTGATACCTCCT
TCTTTCTGCAGACGTGCCCTCGCTCGCGATATACATGATCTAGCTGTGTC
CACCGTGCCGGCTTTACTTTCGCCGC