Blastocladiella emersonii clone report

Clone ID BeCSAS2425
Best BLASTX Match ref|NP_001029540.1|
Function Description hypothetical protein LOC509896 [Bos taurus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2425
CGCCACCGCCACCGCCGCCGCCCCCGCGGAACCCGCGAGCACCTCGACGC
TCGGCCGCCTGCGCAGCATGGTGACGCCGCGGTGCTCGACGCGCCGCTCC
ACCCCGCTCGGCGCGCGCCACGGCGACCACGGGTCCGTCAGCCTCAACAC
CAAGGACGCGCGCCAGCTCGCGCAGTACCGCAAGGCCGAGGCCGAGCTGC
TGCGGTACCTGCCCGCTGACGTGACGCCGCGCCTGCACCGCGTGCAGATC
CCGCACGAGTTCTGGTCCGACGACTCGCCGCTCGCCGCCGCCGCCAAAAA
GCCCGGTGTCCTGTGCGGCAAGCGCCGCAAGGGGCCCGAGTACTTTGAGA
TCAACACGCTCGAGGTGCAGCACACGCGCAACGTCGAGGGTGAGGTCAAG
AAGCCGCACCTCGTCCTCGTCCACGGGTGGGCTGGCGCGCTCGGCATGTG
GCTCAAGAACTACGAGACGCTGTCGCAGCACTACCACGTCCACGCTCTCG
ACCTGCTCGGCTGGGGCGGCTCGTCGCGCCCGACCTTCTCAGACCACTTC
ACGCCGTCGCCCGAGGCCGCGCAGGCCTTCTTCGTCGAGTCGCTCGAGGC
GTGGCGTCGCGCGCAGGGCATCGACAAGTTCACGCTCGTCGGCCACTCCA
TGGGCGGCTTCGTGTCCGCGTCCTACTCGCTCAAGTACCCGGACCGCCTC
GACAAGACGGTGCTGCTGTCGCCCATCGGCCTGCAGGGCTTCACTGCGAG
CGGCGGGTTCCGCGGCGCGAGCCTCGGCCAGCGCCTGCAGACGGAGCTCC
TGCACCGCGCGTGGAACATCACCCCGCAGCGGCTCCTGTCGCTCGCCGGC
GAGACCCGCGCGCGCGCCGTCATGTCGCGCGTCCGGTCGCGCGTCGCCAA
CGTGTTCGGCACCGACTCGGTGCCGCCAGAGACCCTCGTCGAGTACCTCC
TCGCCGGCGTCCAGCGGTCGCCCGGCCGGTCCGGCGAGGCTGCCTTCACC
GCCCTCATGTCGCCGTTCCGCGGGTGGACGCTCCCGCTCGACGCGCAGCT
GCGCGAGGCGATTGCGGGTGGCAAGTTCCCGCCGCTCGTCCTCGCGTACG
GCGTCGCGGACTGGATCGACCCGCGCTACGCCGTGCACACCCTCGCTCCG
GCGGTCCCGCACGGACGCGCGCACGCGTACCTCCTCGACGGCGCGGGGCA
CCACGGGTACGTCGAGGCCGCGCACGAGTTCCACAGGTCGTCCTGCGCG