Blastocladiella emersonii clone report

Clone ID BeCSAS2424
Best BLASTX Match emb|CAB55552.1|
Function Description Fox2 protein [Glomus mosseae]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2424
GCGCGACAAGTCGTTTGCCCGCGTCACGGACGCGGACTGGGACCTGATCC
ACCGCATCCACCTGCGCGCCTCGTACAAGGTAATCAAGGCGGCGTGGCCC
CACATGCTCAAGCAGAAGTACGGCCGCATCATCAACACGTCGTCGGCCGT
CGGCCTGTACGGCAACTTTGGCCAGACCAACTACTCGGCGGCCAAGGCCG
GCATCATCGGCCTGTCCAACACGCTCGCCATCGAGGGCAAGAAGCACAAC
ATTGTCGTCAACACGATCGCGCCCAACGCCGGCACCGCCATGACGGCCAC
GGTCATGCCGCCCGATATGGTCGAGGCCCTCAAGCCCGAGTACGTGGCGC
CCCTCGTCGGCTACCTCGCGCACGAGGCCAACACGCACACGGGCGGCATC
TACGAGTGCGGCTCCGGGTGGGCCGCCGCCGTCCGCTGGCAGCGCACCGG
CGGCGTCGGGTTCCCGCACAACAAGGAGCTCACGCCCGAGGCCATCCTCG
CCAAGTGGGACCAGATCTGCGATTTCGACGACGGCCGCGCCGCGTACCCG
GTGTCGACGCAGGACTCGTTCCAGACCATCTACGGCAACATCACCAACAC
CAACGAGGCCGACGCCAAGGCCGCCAAGGCCGCCAA