Blastocladiella emersonii clone report

Clone ID BeCSAS2422
Best BLASTX Match gb|EAS29172.1|
Function Description hypothetical protein CIMG_07918 [Coccidioides immitis RS]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2422
CACGCGTCCGGCGTCGAGGCCGCCTTCGACGTGCTGTTCGAGATCCACGA
GCCCGTCAAGACCGGGACGTGGGTCGGCGACTGCTTCCTGTACACGTCGG
CGGCCAACCGGCTCAACTACACGGTGGGCGGGCACGTGTTCACGCTCACG
CACTTTGACAACCCCATGTACCTGCTCGGGTACCTCGCCAAGGACAACCG
CGTCTACTACTGCGACAAGGAGGTCAACTTCTTCTCGTGGAGCCTGCCGC
TCGCCGTGATCCAGTACCAGACGGCGATCCTGCGCCGCGACCTCGACGCC
GCCAACGCCGTGCTCCCGTCGGTCGCCACGGCCGACCGCGACAAGCTCGC
CCAGTTCCTCGAAAAGCAGGGGCTCGTGGACCTTGCGCTCGAGGTGACGA
GCGACCAGGACCACAAGTTTGACCTCGCCGTCGCCGCGGGCAAGCTCGAC
GTCGCCTTCGCCATCGCCGCCGAGGCCGACCAGCCCGCCAAGTGGAAGGT
GGTCGCCGACGGCGCCCTCGCCGCGTGGCGCTTCGACATTGCCGAGGAGT
GCCTGCGCCGCGCCGCCGACCTCGAGGGGCTCATGCTCCTGTACCTGTCG
GCGGGCAACGCCACCGGGCTCCGCGACGTGGCCACGCAGGCGGTCGCCGC
CAACAAGCACAACGTCGCGTTCGCCGCCCTCACGGCGCTCGGCGACGCGC
ACGCCGCCATCGACCTGCTCGTCGACACGGACCGCGTCCCCGAGGCCGCA
CTCGCCGCACGCACGCTCGCGCCCGCCAAGGTGCCCGAGGTCACCGCCAA
GTGGCGCGCGTCGCTCCCCGCGCGGCTCGCTGGGACCATCGGCGATATCG
AGATCCCCGCCGAGTGGGC