Blastocladiella emersonii clone report

Clone ID BeCSAS2421
Best BLASTX Match emb|CAB75417.1|
Function Description ptr3 [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2421
CGCGTCCGGCAGCAAACTTCCTGCAAGCGCCACCCGCCGCGCTGCATCTC
GTCCCGTGCCCGCCGCGTTTGCTAAAAGCAGCCCAAGAACCGCCATCTCG
CCTCTACCATGTCGGCCACCATGGACGTCGACAAGCCCGCCGCCGAGCAG
ACCATTGATGAGGGTCTCTACTCGCGCCAGATCTACGCGATCGGCCTCGA
TGCCATGAAGAAGATGGCCGCGTCCAACGTGCTGATCATCGGCATGAAGG
GTCTCGGCGTCGAGCTCGCCAAGAACGTGGTGCTCGCCGGCGTCAAGTCG
GTGACCATCTACGACCCGGAGCCGGCCCAGCTCGCCGACCTGTCGTCGCA
GTTCTTCCTCACCGAGCAGGACGTGGGCAAGCGCCGCGACCACGTCACCC
AGCCCAAGCTCGCCGAGCTCAACCAGTACGTGCCCGTGTCCGTGCTCGAC
GGCGAGTTCGCCCTCGACCGCCTGCAGGCGTTCCAGGTCGTGGTCGTCAC
CTCGGCCACGCTCCACCGCGTCATGGAGATCAACGACTACACCCACGCCC
ACGGCATCAAGTTCATTGCCGTCGACACCCGCGGTCTCGCCGCCTTCGCC
TTCTGCGACTTCGGCGCCGGCTTCGAGGTCACCGACGCCACGGGCGAGCC
TGCCCACTTCGGCATGCTCGCCGCCATCTCGTCCGACAAGGAGGGCGTCG
TGACGTGCCTCGACGAGACGCGCCACGGGCTCGAGGACGGCGACCACGTC
ACGTTCACCGAGGTGGTTGGCATGGACGGCCTCAACGACTGCGCCCCGCG
CAAGGTCAAGGTGCTCGGCCCCTTCACCTTCTCGATCGGCGACACGACCG
GGCTCGGCCAGTACGTGCGCGGCGGCATCTTCAAGCAGGTCAAGATGCCC
GTCAAGCTCGACTTCAAGTCCGTGTCGGCGTCCATCAAGGACCCCGAGTA
CCTCTTCTCCGACTTTGCCAAGTTCGACGTGCCGCCGCAGCTCCACGCCG
CCTTCTACGCGCTGTCCGAGTTTGTCGCCCAGCACGGCCGCGTGCCCGTG
CCGCGCAACGAGGACGACGCGGCCGAGGTGCTCGCCAAGGCCAAGGCGTT
TGCCGCCACGCTCAAGGACCCCGTCGAGGTCAACGAGAAGCTCGTCAAGC
TGTTCGCGTGCTCGGGCAAGTTCCACCCGCTCAAGCAGTACCTGTACTTT
GACTCGTTCGAGTCGCTGCCGCAGTCCTACTCGCTGACGCAGTCCAAGTG
CGCCATGCGCGGCACCCGGTACGACGGCCAGATTGCCGTGTTCGGGTCCG
ACTTCCAGCGCCGCATCCAGGAGTCGCGCAAGTTCCTCGTCGGGTCGGGC
GCCATCGGGTGCGAGATGCTCAAGAACTGGGCCATGATGGGCGTCGGCAC
CTCGGGCGACGGTCAAATCTTCGTCACGGACATGGACTCGATCGAGAAGT
CGAACCTCAACCGCCAGTTCCTGTTCCGCCCGTGGGACGTGTCCAAGCTC
AAGTCGGCGACGGCGGCGGCGGCGGTGCGCAACATGAACGGCGAGCTGCA
GATCACCACGTTCACGGACCGCGTGGGTGCCGACACGGAGCACATTTTCA
ACGACGCGTTCTGGGGGCAGCTCGACGTGGTGACCAACGCGCTCGACAAC
GTGGACGCGCGCAAGTACGTGGACCGGCGGTGCGTCTTCTACAACAAGCC
ACTGCTCGAGTCGGGCACGCTCGGGACCAAGGGCAACACGCAGGTGATCC
TGCCGCACAAGACCGAGTCGTACTCGTCGAGCCAGGACCCGCCCGAGAAG
TCGATCCCGATCTGCACGCTCAAGAACTTCCCGAACCAGATCGAGCACAC
GATCCAGTGGGCGCGCGACCTGTTTGAGGGCCTGTTCCGCCAGCCGGCCG
AGAACGTGAACCTGTACCTGTCGGAGCCCAAGTTCATTGAGCAGACGATG
CGCAGCAACTCGGCCCGCGACACGCTG