Blastocladiella emersonii clone report

Clone ID BeCSAS2415
Best BLASTX Match gb|ABA25222.1|
Function Description Heat shock protein DnaJ-like [Anabaena variabilis ATCC 29413]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2415
CATCAAGCAACGCATCACCGCCATGGCACCAGCCCCATCCGCGACCTCGC
GCACCGAGCTGCCCGACTACTACGCGACGCTGCAGGTCGCCCCGTCCGCC
GCCTTCAAGGACATTCTCGCCGCGTACCAGCGCGAGGCCCTGCGCCTGCA
CCCGGACCTGCACCCCAAGGACGGCGTGACCGACGCCGCCTTTGCGCTCG
TCAACGAGGCCTACGTCGTGCTGTCGGACCCGACCCGCCGCAAAAAGTAC
GACGCGGCGC