Blastocladiella emersonii clone report

Clone ID BeCSAS2411
Best BLASTX Match gb|AAH33588.1|
Function Description Transmembrane protein 32 [Homo sapiens]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2411
CCAAGCACGGCCAGCTGCCGGCCAACTTCCGCGAGAAGACCATGTGCTTC
TGGCTCAAGGAGTACATACTCTCGCGCGTGCGCGCGTCGTGGACGTCCGA
CGACGGGCACGCCGGGGACGTGGACCTGGCCGCGCTCGCCGTCGACCCGG
CGCACATCCCGCTCCTGTGGGAGCAGTCGATCGACGTCGCCGTCGCCCGC
GTCACCCGGTCGCCCGTGACGCCGCACCTGCACGAGGTCACGCTCGCCGT
GCACAACCACGCCGACATGCCGCAGAACTTTCTGGTCCAGGTCCGCCCCG
ACGCGCTCGCGGGCGTCCGGCTGCTCGGCCACCCGGCCGTCACGCTGTGC
GGGGTCCCCGCGCGCGAGGCCCGCGAGGTCGTGGTCCGCGCGCTCGGCCG
GCCCGCGGCGCCCTGGACGCTCCTGTGCCACGCGGCGCGCGTGGGCACCC
CGCACCCGCTCGTTAGCGCGCTCAAGTTCGTGGTGCCGGTGCCCGAGGTC
GCGTGAAGTGAGGGAGGGAGAGGAACGCATTTCATATATAGATTCGGTCA
CATCATCACTCTTGCGCGGGCGCCGCAGACGCAGCGAGGAGCGCGCTAAA
GTGGCGGGCGCGGTGGCCGAAGCTGTGGTAGCTCGGGCGCGCCTCAAAGG
CGTTGCGCGACTGCTTCTTGAGCTCCGAGTGCAGCGCCAGCTCTTGCAGC
GGGTCGGCGACCAGCGCGATCCCGACAAAGCACAGCAGCATCGAGATGAG
CGTCTCGAGGATGATGTCGGTCGTCAGGCCGTCGTCGACCCGGTCGATCG
TCTTGAGGTACGCCACGTGCTCGAGCGCCGAGTACCCGGCGTGCGCGAGC
AGCAGGAACGCCGAGAGCAGCACGGCGCGGCCGGTCCAGGAGACGGAGGA
GGACGAG