Blastocladiella emersonii clone report

Clone ID BeCSAS2409
Best BLASTX Match ref|XP_636144.1|
Function Description hypothetical protein DDB0219474 [Dictyostelium discoideum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2409
CGCGTCCGGGAACTTCTTGCAAACCGGCAACCTGCTGGCTGTGCCGACCG
TCTACGCTGTCCTGGCGATCGTCGCGCATGTCGCCAACTACAACCTGACA
GCGCAGCTGGAATATGCCACGCGCATCTTTACCAAGGTCCGGAGCTGGTG
CTTGCTCCGGCACACGCAATATTGAGCCACCTGCTGCGCGTAGATCCTCG
GCAGCAACGCAATCTACGTCTACGCCGTCTACTTGATCTTGTCGGCCCTT
GCGCGAGACTACGTGATCGAGCTGGCCATGGACAACGACCTGTACTCCGT
ACGCCTCCTCGACACCTACTACAGTTGAACTGCGACGCTCCGCTGACACA
CGATACTTGTAGCTTGTGCTCATTCCGCAAACCGTGGCAAACGTCGCAGG
TTACAGCCTGTTTGTCGCGGGCATCCTCATCAACCTGTGGACGCTCAAGG
CGCTCGGCATCAAGAACATGTACAACGGCGACAGCTTCGGGTACCTCATG
GACAGCATTGTCACCGACGGACCGTACAAGTTCTTCAACGACCCGCAGTA
CGTTGGCACGTCGATCGCGTGCCTCGGGTACGCTGTCCTCAAGCAGTCGC
TCGTCGGCTACGCGCTCGCGGCTGTCATGTGGGCCGTGTTCCAGTTCAGC
GTCAAGTT