Blastocladiella emersonii clone report

Clone ID BeCSAS2408
Best BLASTX Match ref|XP_760492.1|
Function Description hypothetical protein UM04345.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2408
GCGTCCGGGACCGCTGCAACGCCTGTCTACCTGCAACCGCCCGCACAAGC
CGCGTCCTGCCGCGCACACGCATCCAAACCGAACCTCTTGCTTGACCATG
GCTGCCCAGAACTCGGCCGGGATCCAGACCCTCCTCGAGGCGGAGAAGGA
GGCCGGCAAGATTGTCCAGCGCGCGCGCCAGTACCGCGTCGAGCGCCTCA
AGGAGGCCCGCAAGGAGGCCGAGAAGGAGATCCAGGCCCTCAAGCAGCAG
AAGGTGGCCGAGTACGGCAAGTTTGAGAAGGAGAACGCCGGCACCAAGGA
CGCGTTCGCCGCCAAGGTGGACGCCGACACCGAGGCGCGCCTGGTCCAGA
CCGCCCAGGACTTTGAAAAGGGCCGCGACGCCGTCATCGACAAGCTCGTC
GCCGCCGTGACCCGCGTCAAGCCGACGCTCCACGTCAACGCCGTCAAGGG
CAAGGTGCCCTCGTACTGAGTCTGCTCGCTGTCTCCTTTCTCTCCCCGCT
CCGTCCCCCGTGAATACCATGCCGCCCGTTTGTGAAC