Blastocladiella emersonii clone report

Clone ID BeCSAS2401
Best BLASTX Match emb|CAE76470.1|
Function Description conserved hypothetical protein [Neurospora crassa]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2401
TTTGGATCGCTCGCCCAACGATCACCGCTACGAATCAACACCACCAGCAC
AGCACCATGCCCGGCCTCTTTGACCTCGAGAGCCAGTTCATCTTCTACGG
CGCCTACCACAAGAATGGCATCAACAAGCTGATCCACATCATCTGCGTGC
CGCTGATCCTGTGGTCGCTGTTCGTGTGGCTGTCGAACACGGGCGAGCTG
GTGCCGCTGGAGATTGTGCGCAAGATCCCGCCGTACCAGGGGTGGGTGCC
CGAGGCCAACGGCGCCTTCCTGGTCGGCCTCGGCTACCTGCTCTACTACC
TGTGCCTCGAGCCCATCGCCACCCTGACCTACGCGCCCATGATGCTGCTC
ACCTTCGTCACGGCCGGCGCCTTTGCCGCCTACGTGCCCAACCACAACTG
GTTCGCCCTCTACGTGCACCTCGCGTCGTGGGCCGGCCAGATCGTTGCCC
ACTACGTGTTCGAGAAGCGCGCGCCCGCGTTCTTTGACTCGGTGCACCAG
GCCTTCGTCATGGCCCCGCTGTTCGTGTGGATGGAGGTCCTGTTCGTCCT
CGGGTACAACCCGGAGCTCGCCGAGCGCCTCGACAAGCAGATCGACGTCG
AGATTGCCAAGTTCCGCGCGACGCAGAAGGGCGGCAAGGCGGCGGTCAAG
GCGGCCAAGACCGAGTAGGCGCGATTATTCGATGATACACATCTTCCCTC
TCCTTCGCG