Blastocladiella emersonii clone report

Clone ID BeCSAS2399
Best BLASTX Match ref|ZP_01307837.1|
Function Description short-chain alcohol dehydrogenase-like protein [Oceanobacter sp. RED65]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2399
AGTCCCTGCCACGAAATCAACACCATGGCCGCCATCTTTATGCGCAAGGA
GCTCCCGACCGTCCTCATCACGGGTGCCAACCGCGGGATCGGTCTCAACC
TGGCCAAGCAGTTCCACCAGCACGGCTTCAACGTGATTGGCACGTCGCGC
AACACGGAGCCGGCCGCTGTCGAGGAGCTGTCGACGGTCGCCGCTGCGGT
CCTGCAGCTCGACGTGTCCGACAACGCGTCGATCGAGGGCCTGGCGACGC
GCGTGCGCGGCGTGGTGGACCACCTCGACGTGGTGGTCAACAACGCGGGC
ATCTTCGAGTCGGACGAGCTCGGCAAGCTGACGCCCGAGACGTTCACGCG
CCAGTTCCAGATCAACACGATCGCGCCGGCGCTCGTGAGCCAGGCGATGC
TGCCGCTGCTGCGCGCGAGCCCGCGCAAGGAGTCGGCCAAGGTGATCCAG
ATCACGTCGCGCATGGGGTCGATCGCCGACAACTCGTCGGGCACCTACTA
CGGGTACCGCGCGTCCAAGGCGGCGCTCAACATGGTCAACAAGACGCTGG
CGTGCGACGCCAAGGACGTGACGTTCATTGCGCTGCACCCGGGCTACATC
CAGACGCGCATGACGGCCGGTAAGGGCGACATGGGCCCCGAGGAGTGCGC
GGCCAAGCTGTACGAGCAGATCGCCAAGGCCACGATCAAGGACTCGGGCA
AGTTCATCCACCGCGACGGCTTCGAGCTGGAGTTCTGAGCGCGTCCCGAT
GAGCGGAGTGGGCGTGACGCTTTGTGATTTGTCAGTGTCTCCAACAGAGT
TTGCCTCAGAGTC