Blastocladiella emersonii clone report

Clone ID BeCSAS2390
Best BLASTX Match ref|XP_420301.1|
Function Description PREDICTED: similar to ATP-binding cassette, sub-family B, member 7; ATP-binding cassette 7; Anemia, sideroblastic, with spinocerebellar ataxia [Gallus gallus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2390
CCACGACCGCATCCTCGAGTTCCCGCTCGGGTACAACACGCGCGTCGGCG
AACGCGGATCGCTCCTCTCCGGCGGCGAGCGCCAGCGCGTCGCCCTCGCA
CGCGCACTCATCCGCACCGACGCGCGCATCCTCGCCCTCGACGAGAGCTC
CGCCGCCCTCGATTCGCGGTCCGAGGCCGCCGTCCTCGCGGCCATCGACG
ATTTCTTGCACCACCCCGCCGACCCCACGCAGCCCCCGCCCATGGCGATC
TTCGTCGCGCACCGGTTGACCACCGTCGCGGGGTGTTCGAGGATTTTCGT
CCTCCGCGAGGGCCGCGTCGTCGAGATGGGCAACCACGCGGAGCTCCTCG
CGATCCCTGGCGGGCTGTACCGCGAAATGTGGTACACGCAGCAGCAGCAG
GCGGACGAGGCCATGGCCGCGGCTGAAGAGGAGCCCGTTACGGTCGTCGC
GCCCGCGGGGACGGCGCGCGTGGTTGATGTGTAAGAGATATAACGAAGAA
TATAGCAAGAAGAGTTC