Blastocladiella emersonii clone report

Clone ID BeCSAS2388
Best BLASTX Match gb|EAS30438.1|
Function Description hypothetical protein CIMG_05917 [Coccidioides immitis RS]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2388
GATCGAGACGGAGCGCAACGGCGAGTCGGTGGACCGGTCCATGCTCAAGG
CCGTGCTCGACTCGTTTGTCGCGCTCGACCTGCCCAACGGCGACGCGGTC
GACGCGGGCACGGCGCAGGGGCCCGAGACGTACAAGCACACATTTGAGGA
CAAGTTCCTCACGGCGACCTCCACCTACTACAAGGCCGAGTCGTCCAAGT
TCCTCGCCGAGAACTCGGTCACCGAGTACATGAAGAAGGCCGAGACGCGC
CTCGCCGAGGAGCTCGACCGCGTCAAGATGTACCTGCACGCGTCGACCGA
GGCCACGCTGATCCGCCTGTGCGAGGAGCGCCTCATCCTCGACCACGACG
CGGTGCTGCGCGACGAGTTCCAGGTGCTGCTCGCCTCGGACAAGAACGAG
GACATGGAGCGCATGTACCGGCTCGTGTCGCGCACGCCCGACCGCCTCGA
GCCCCTCCGCGGCAAGCTCGAGGTGTACGTGTCCAGCATCGGCAAGCAGG
CCGTCGAGAAGGTCGCCGGCGACCTGTCGGACGACGCGCCGCTCGACGCC
AAGGTGTACGTGGACGCGCTGCTCGTCGTGTACCACAAGTACGCGTCGCT
GGTCGCGCGCGCGTTCCAGGGCGACGCCGGGTTCGTCGGGTCGCTCGACC
GCGCGTGCCGCGAGTTTGTCAACCGCAACGCCGTGACCGAGACGGCGCCG
TCCAAGTCGTCGGAGCTGCTCGCGCGGTACTCGGACTCGCTGCTCAAGAA
GTCGGCCAAGAACCCCGAGGAGGCCGAGCTCGAGGAGCTGCTCACGTCCA
TCATGACCGTGTTCAAGTTCATC