Blastocladiella emersonii clone report

Clone ID BeCSAS2385
Best BLASTX Match ref|NP_174753.1|
Function Description iron ion binding / isopenicillin-N synthase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Arabidopsis thaliana]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2385
GCCCCCGGCCTCGGCCTCGGCACTCCTCGACGTGCCCGTGTTCGACCAGA
TCCCGGTGCTCGACCTGTCGCCCTTCGCGGGCGTGCCGATCGGCAGCGAG
GACCCGGCGACGCTGGCGGCCATGGGCGCGTTCCTGCGCGACGCGTGCAC
GACGACGGGCTTCTTCCTGGTCACCAACCACGGGCTCCCCGAGTCGCAGC
TCGACGCGACGTTTGCCGCGGCGCGCCGCATGTTCGCGCGCCCGCTCGCC
GACAAGCTGGCGACCAGCAGCGGGTCGGGCCGCGGGTATCTGCCGCTCGG
CGGCGAGCTGCTCAACCCGGACAAGCAGGTCGACGGCGACGTCAAGGAGG
TGTACGGGCTCGGGCCCGACGGCGTCCCCTCGCCCTTTGTCCCGCCGCCC
GAGGGCACCCCCGAGGTTGTGGCCACCATGGCCAAGACGATGCACGCGCC
CAACAAGTGGATCGCCGACGACCCGGCGTTCCGCGACACGGTGACGGGGT
ACTACGACGCGGTGTCGCGCGTCGCCGACCGCGTGCTGCGCGTCCTCGCC
GTCGCCATGGGCCAGCGCGCGTCCTTCTTCCACGACGTCGGCGGCGACTA
CCCGTTCGGCCACCTGCGCCTCGCGCGGTACCCGGGCGTCCCCGCGGACG
CGGTCTCAGAGGCGCGCATCGGGTGCGGCGCCCACGCCGACTTCGGGTGC
ATCACGGTGCTCGCCGCCGACGACGAGGGCCTGCAGGTGTACCTGACGCC
CGAGGCGACGCGCAAGTACCTCCCCGCCACGCACCAGGTTGACCGCGACG
CACCCGTGTCGGCGCACCACACGTCGCTCGAGTACGCGCACACGCGCGGC
GGCGCGTGGGTCCGTGTCCCGCACGTCAACGGCGCGTTCGTCGTCAACAT
CGCCGACATGGTCGCGCGCTGGACGAACAAGCGGTTCAAGTCGACGCTGC
ACCGCGTCGTCTACACGGCCGACGGCAAGGACCGCATCTCGCTGCCCATG
TTCTA