Blastocladiella emersonii clone report

Clone ID BeCSAS2384
Best BLASTX Match ref|XP_756534.1|
Function Description ADP-ribosylation factor [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2384
CTCCTGCACGCGCCCCGACTTCTCTCTCAACACGCCCGCTCTCCCCCCTC
CAGCGTGCCCGCCACCTGTCGCAACCTCCCTCCAGCCAGCCAACCACCAC
CACCACACTCGCCAAGATGGGTTTGTCGATCTCCAAGCTGCTCTCCTCGC
TCTTCGGTAAGCAGGAGATGCGCATCCTCATGGTCGGTCTCGACGCGGCC
GGTAAGACCACCATCCTGTACAAGCTCAAGCTCGGCGAGATTGTGACCAC
CATCCCGACCATCGGCTTCAACGTCGAGACCGTCGAGTACAAGAACATCT
CCTTCACCGTCTGGGACGTCGGAGGCCAGGACAAGATCCGTCCCCTGTGG
CGCCACTACTTCCAGAACACGCAGGGCATCATCTTCGTGGTCGACTCCAA
CGACCGCGAGCGCGTCAACGAGGCGCGCGACGAGCTGCAGCGCATGCTCA
ACGAGGACGAGCTGCGCAACGCCATCCTGCTCGTCTTCGCCAACAAGCAG
GATCTGCCCAACGCCATGCAGGCCGCCGAGATCACCGACAAGCTCGGCCT
CCAGTCGCTCCGCCAGCGCGAGTGGTACATCCAGGCCACGTGCGCCACCA
CCGGCGACGGCCTCTACGAGGGCCTCGAGTGGCTCTCCAACACGCTCAAG
AAGAAGGCCTAAGTCGTTCGTGTCTTGTTGATCGCTCTCCTCCGTCGCTC
TTGCGCGTCTCGCTTCTCTACCCCTACCGCCCGCCGTTGTTCTTATCATT
GAATTCTATTCAGTACTCTGCTAAAAAAAAAAA