Blastocladiella emersonii clone report

Clone ID BeCSAS2383
Best BLASTX Match ref|NP_001018585.1|
Function Description hypothetical protein LOC553787 [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2383
GTCCGACGAAGCTGATGAAAAATGTCTAGCACCGTGCTTCCAGAGTCATT
TTACGAGCAGTTGCCGAAGCGGTATCGCGCCGGTGAGGCCAAGGAGAGCA
ACAAGGGCTTCAGCAAGACGCTGGTGCAGCAGATCATTGAGCAGCATGAG
CCCTTCGTGCAGTCCAAGTACAGCTCGACGGGCGCCGTGTCGTCGCTGTC
GACGAGCCTGCCGCTCGACAACCTGCCCGAGCAGTTCCGCGCCAAGGGCA
AGGACAAGGCGGCCGAGCGCCGCGAGCGCAAGGAGCTGCGCAAGCGCAAG
TACCTGACGTCGCGCGAGCGCCGGAAGCTCAACCTGCTCAGCATCCCGAC
CGAGTGCCGCAAGTTCGACCTCCTGCTGCCGCTGCACCAGCTGTGGGAGC
AGTACATGGTCGACCTGCGCACGTCCACGGCCGCTAGCGGGGCAGGGCCT
AGCGACCAGTTCCTCGCCAAGCTCGTCAAGGCCGACTTTCACGGCGCTCT
CCTCACGGTGGTCCGCGCGACGTGCCCAACACGCATCGGGATCACGGGCA
TCGTGGTGCAGGAGACGAGCAACACGTTCAAGGTGGTGACGCGCAGCAAC
GAGCTCAAGTCGGTGGCCAAGGAGGGCACCGTCTTCTCGCTCGCCGTCAA
GGGCACGCTGTACACGCTGTTCGGCAACCAGATCCGGTACCGGTCGAGCG
AGCGCGCCGCGCGCAAGTTCAAGAGCAAGCCGACCATCGACATGTGAGCG
TGAGCGTGGGCGGCGTGTAATAAAGTTTGGGTGG