Blastocladiella emersonii clone report

Clone ID BeCSAS2381
Best BLASTX Match gb|AAT07073.1|
Function Description small heat shock protein [Chaetomium globosum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2381
GCGTCCGAGCTACGCAATCAACCACCAAGATGTCGCTCCTCCGCACCGTG
CTCCCCGAGATGGCGCGCATGGCGCGCGCGTTCGAGGACCCGTTCCTGCT
GCCGCTGCGCCGCGGCGGCGCGTTCAGCCCGTCGGCCGCGGGCGCGCTCG
CGTCGGCGTTTGGCGGGCCGCGGATCCCGGCCATGGACGTTCACGGTACG
CGGTCGCGAGTGCATCCCTCGATGCACACGGACACTCACTTCGGGCAACA
TGAACGCGACGTAGAGAACGACAAGGAGTACGTGGTAGTCGCCGAGCTGC
CGGGCGTGGCCAAGGACGCCATGGACGTGAGCATCGTCGACGGGAACACG
CTGTCGATCCACGCCACGGCCAAGGCCGAGTTCTCCGCCCCCTCGTCCTC
CTCGGCCGCCGGCGATGCCAACGAGGGCCTGTCGCCGACGACGGGCGGCG
AGGCGCTGACCGACACGGCGACGGCGCCCAACGAGTCCGCGGTCAAGTCG
TCGCCGACCGCGGCGACGCACCAGCTGATCGCGCAGGAGCGCGTGATCGA
GGACTTCCAGCGCACCGTCACGTTCCCGCACCGCATCGACCCGGGCCAGC
TCATGGCCAGCTTCAAGGACGGCCTGCTCACGGTCACGGTGCCCAGGCCG
CGCCGCAAGTCGAGCGCGTCCAGGTCAAGATCGAGTAGGGGTGAGTGTGT
TTGGCATTTTGTGTACCACATATGCAAAGA