Blastocladiella emersonii clone report

Clone ID BeCSAS2378
Best BLASTX Match ref|XP_381422.1|
Function Description hypothetical protein FG01246.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2378
GCGTCCGAAACTGCAATGACCACGACCGACCCGACCGCCTTCCGCGTCGC
CCAGAAGGGCGTTCCCGGCGCCGCGACCGCCAAGTCCGCGGACACGCCGC
TGCCGCCGCTGTTCCGCCCGCTGTCGCTGCGCGGCGTCGATCTGCCGAAC
CGCATCTCCGTGTCGCCCATGTGCATGTACTCGTCGCAGGACGGCTTCGC
GACCGACTTCCACCTGGTGCACGTCGGCCAGTTCGCGGTGCGCGGCGTCG
GCCTGACCATGATCGAGGCGACCGCCGTCGCGCCCGAGGGCCGCATCTCG
CCGCAGGACCTGGGCATCTGGAAGGACGAGCACGTCGCCGGGCTCAAGCG
CGTCACCGACTTTGTGCACAGCGTCAACGGCAAGGTGGCCATCCAGCTCG
CGCACGCCGGCCGCAAGGCGTCGACCTACCCGCTGTTCCTCAAGGACGGC
CGCAGCCTGGTCCCCGAGTCGGACGGCGGGTGGCCCGCGCAGGTCGTTGG
GCCCTCGCCCGTGCAGTGGTCCGACTACATGGCGCAGCCGCACGAGCTGA
CCGTCGCCGAGATCCAGCGCCTGGTGCGCGATTTCGGCGAAGCCGCGCGC
CGGTCCGAGCTCGCCGGGTTCGACGTGGTCGAGATCCACGGCGCCCACGG
CTACCTCATCCACCAGTTCCTCTCCCCGCTCTCGAACCACCGCACCGACG
CGTACGGCGGCTCGCTCGAGAATCGCGCCCGGTTCCTGACCGAGGTCGTG
GCCGCGGTCCGCGCCAACTGGCCCGAGACCAAGCCCGTCTTCCTGCGCCT
GTCGTGCACCGACTGGGTCGAGTCGTCGTCGTGGGACATCCAGGAGGTGA
CCGAGGTCGTCAAGCTCGTGGCCGCGCTCGGCGTCGACGTCGTCGACTGC
TCGACGGGCGGCAACCAC