Blastocladiella emersonii clone report

Clone ID BeCSAS2377
Best BLASTX Match gb|AAL54860.1|
Function Description histone H4 [Aplysia californica]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2377
GTACCCGGCACGACTCGCATTCGTGCTACCCATCACAGACCCTCCACCAG
CACCACCACCTCATCACCATGTCTGGACGCGGCAAGGGCGGCAAGGGCCT
CGGCAAGGGCGGCGCCAAGCGCCACCGTAAGATTCTTCGCGACAACATCC
AGGGCATCACCAAGCCCGCCATCCGCCGTCTCGCGCGTCGTGGTGGTGTC
AAGCGTATCTCGGGCCTCATCTACGAGGAGACCCGCGGTGTCCTCAAGTC
GTTCCTCGAGTCGGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCA
AGTGCAAGACCGTCACGTCGCTCGACGTCGTCTACTCGCTCAAGCGCCAG
GGCCGCACCCTCTACGGCTTTGGCGGCTAAGCAGCTCGCTCCTCGCCTCG
CCTCCAAGCACCACCAGCAGTAGTCCAAGCTCCTGCACCTTCTTTGTCAT
TCCCTCCCCTTTGTTCACTAACCGGCTATTCTCATAGCCCCAAACACGCT
ATCCCAATGCAATCAACATGTTGCCCCTGAATC