Blastocladiella emersonii clone report

Clone ID BeCSAS2376
Best BLASTX Match ref|XP_689262.1|
Function Description PREDICTED: similar to CG32369-PB, isoform B [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2376
CCCGCCGACACCACCGAAACCCCCCTCGCGGCGTGGTCCGACTTCGAGTC
GCACTTCGACTGCCCGCTGTGCTACCAGCCGTACTACGACCCGGTGACGA
TCGCGTCGTGCGGGCACACGGGGTGCCGTTCGTGCCTGCTGCGCACGCTG
GACCACGCGGCCGAGCAGCGCGGCGAGTTCCGGTGCTTCGTGTGCCGGTC
GCCGCTGCCCGGGTCGTACCTCGCGTACCACCAGCACCCGGCGAACACGG
CGCTCGCGCGCGTGTTTAAGCGCGGGTTCCCCGAGCAGTTCGCGGTGCGC
AAGGCCGCCGTTGAGGCTGAGCTCGCGGCGAACGCGGGCGGCGCGACGGC
AGCGACGGCTGCAGTTAATGAGGAAGAGGAGGGCGCAGACCTGGACGCGC
CAACCGTGTACCGCAACGTGCCGCTGTTCGTGTGCAACGTGGCGCTGCCG
GGCGAGCACGCGCCGTTCCACCTGTTCGAGCCGCGGTACCGCCTGATGCT
GCGTCGGGTCACGGCGCCCGGCGCGTCGCGGCGGTTTGGGCTCGTCATGC
ACCACCCGCGCGGTGGGATGGTCGGGCTCGGCACGATGCTGCGCGTCGAC
GACGTGCGGTTCCTGCCCGACGGCCGCGCCCTGATCGACTCGCGCGGCGA
GTTTGCCTTCCGCATCGTCCCCGACACGGTACACGTGGCAGACGGCGGGT
ACGCGGCGGCGGACGTCGAGACCGTGGTCGACGAAGAGTTTTTGGCCGCG
GCCGACCCGGTCCCCGCGGGGGCCGCCGTGCAGCTCGCGGCGCGCATGCG
GCGGCGGTTCGCCGAGGCGGCAGTCCTCCCGCCGACGGCGTCGTTTGACT
CGGTCGCGGATCTCACAGCGCTGCTGGCGGCGGCGCACCGCACGTTCCTC
GAGTCGCTCCCGCCGCAGCACCGCGACGCGGTCCGGCGGGCCACGGGCGA
CGGCCCGCCCGACGACCCGGCGATGCTCGCGTACTGGATCGCTGGCACGC
TCGACGTCGACGACATGGCCAAGTTCCGGCTCCTCGCGCTGCAGTCGCCG
CGCGACCGGCTCGCGCTCG