Blastocladiella emersonii clone report

Clone ID BeCSAS2373
Best BLASTX Match ref|NP_511149.2|
Function Description retinal degeneration B CG11111-PB, isoform B [Drosophila melanogaster]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2373
GAACGCGACGCCCGCGCCGGGGATCCCGCCCGCGACCGAGCCCGTCGACG
TGCCCATCTCGCGCGTCTTCTGCATGGGCAGCCCGATCAGCAACGCGCTG
GTCCTGCGCGGCCACGATCCCGACGCGTACGCGCCGCGCGCCCAGTTCTT
CAACGTGTACCACCCGCTCGACCCGATCGCGTACCGCTACGAGCCTCTGT
TCGACGCGCGCTGGGCCGACCATCCGCCCGTCCCCGTCCCGCTCTACACG
GATGGGAGCGCGCCGGGCGGCGACGCGCTGCACGTCCGGCTGCTGGGATC
GATTGCCGCGCGCGTGCCCACCATCGCCATGCCCGCCATGCCCGGCCTGC
CGCCGCTCCTCCCGACCATCGTCACCCAGAGCGTGCGCTCGTTTGCCGCC
AGCGTGCTTGCCGTCGGGTCGGGCCGCTTCGAGGACGCGCACCACCCCGG
CGGTGGGAGCGACGAGGACGGCGAGGATGACGGGTACGCGTCCGACAACG
AGGCGAGCCCCGAGGGGTGCGGGACCCCCGCCGAGGACGACGAGGACGAT
GACGAGGAGAGCGTCGCTGTTGCCGCCTCAATGGACCTCGACCAGAAGTC
CGCCAGCCCATTGAGCGACGACGGGGACGACTGGGTCA