Blastocladiella emersonii clone report

Clone ID BeCSAS2372
Best BLASTX Match gb|AAF36156.1|
Function Description HSPC236 [Homo sapiens]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2372
CTTGCATACGGAAAAGACTTGTCGCAACGAATTACCACCATGCAGCCTTC
TCTCGCCTCTGCCGCCGCCCCGACGCCGCTCTTCGGTGGAGGCCTTGAGG
CCGTGTTCCCGGCCGAGCTCATCGACGTCAGCCAGTTCCGCCAGGTTCCC
GACAACCAGGAGGTGTGGGTCGATGCAACCACCTCGGCCGTCCCCTCGGT
GCCTGGTTCCGCGCCGGCACCCGCGACGCAGGACTCGGCGTCGCTGATCA
TCGAGCTGCTCGAGCTCGACGAGACCGTGTCGATTGACGCCATGGCGACG
TTCCACCTCGACCAGGTGGCGCGCGACGCCGAGTCCGAGGGCTACACGCC
GCTGCAGACGGGCTCGCTCAGCGACGGCGCGTGCCGCATGAGCGC