Blastocladiella emersonii clone report

Clone ID BeCSAS2371
Best BLASTX Match ref|NP_001016076.1|
Function Description eukaryotic translation initiation factor 4E member 2 [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2371
GCGCGACGCACGCCCGCACACCGACCACCATGAATCACCCTGCAATGACG
ACAGCGCGTCCAGCGGGCGAGCACGCGCTCGCGCACGCGTGGACGGTGTA
CTACTCGCACCGGACGCCGGCGCAGCGGATCACCAACTACGAGGACGCGA
TCAAGAATCTGGGCGAGTTTGCGACGGTCGAGGCGTTCTGGCGCGTGTAC
TCGCACCTCAAGCGGCCAAGCGAGATTGCGCCCATCACCGACTTCCAGAT
CTTCAAGGCGGGCGTGCGGCCCATGTGGGAGGACAAGGAGAACATCCACG
GCGGCAAGTGGATGATCAGGCTGCGCAAGGGCCTGTCGCAACGTTTCTGG
GAGGACTTGATCCTCGGCGTCATCGGCGAGCAGTTCACGGACCCCATCAA
CGGCATCGTGCTGTCGATCCGCGGCAGCGAAGACATCCTCAGCGTGTGGA
CAGCGCACGCGGGCGACGGCGCCGAGGTGCTGCGCATCCGCGACGCCATC
AAGGCCCTGCTGCAGCTGCCCGAGACGGCCGTCCTCGAGTACAAGCAGCA
CAATGAGTCGCTCAAGGACAACTCGTCCTTCCGCAACACGGACATTTTCC
GGTGAGCTTTGTGGTCGACGCGCGGCGCGCGCGTGCGTGTGCGTGCGTGT
GCGTGCGTGTGCGTGTACTGATCTCTCGTTTTGAGCCCTCGGAGTGAATA
CACGTCCCCTCGCCTCGCGC