Blastocladiella emersonii clone report

Clone ID BeCSAS2369
Best BLASTX Match gb|AAR11779.1|
Function Description cyclophilin A [Chlamys farreri]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2369
CGAGCCTGACCTCAAAGCAACGTAATCAAGATGTCGTCCAACCCCCGCGT
CTACTTCGACATGACTGCCGACGGCAAGCCGCTCGGCCGCATCGTCATGG
AGCTGCGCGCTGATGTGGTCCCAAAGACTGCCGAGAATTTCCGTGCCCTC
TGCACCGGCGAGAAGGGCTTCGGCTACTCGGGCTCGACCTTCCACCGCGT
GATCCCCGACTTCATGTGCCAGGGCGGCGACTTTACGGCCCATAACGGTA
CCGGCGGCAAGAGTATCTACGGGAACAAGTTTGCCGATGAGAACTTTGTC
CTCAAGCACACTGGCCCGTACCTGCTGTCGATGGCCAACGCCGGCCCCAA
CACCAACGGCTCGCAGTTCTTCATCACCACGACCAAGACGGCCTGGCTCG
ATGGCAAGCATGTCGTGTTCGGCTCCGTTATCGAGGGCCAGGACGTCGTG
AAGACGATCGAGTCGTACGGCAGCTCGTCGGGCCGCACCTCGGCCAAGAT
CGCCGTCGCCGCCTCGGGCCAGCTCTAAGTTCCTGGGACACCGCTACCGC
TACGACCCGCCCACCAAGAATGACCCGCCGAGCACGCAGTTTGTCTCTCT
CGAGTTCCTCCTCCTCCTGTTCCTCCTGATCTTCTGGTGAGACGGGTCTG
ATCGTCGTCATTCGACGTGAAGCCGTCCTCCAGCGAGCGTTTGAAGAAAA
ACATACATGGAAGTCCTTCTGTGAAAAANAAAA