Blastocladiella emersonii clone report

Clone ID BeCSAS2368
Best BLASTX Match ref|XP_454677.1|
Function Description unnamed protein product [Kluyveromyces lactis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2368
ATTTTTGCCGCGTCCCCCGCCGTTCGTCCATCACTTTGAACGCAAAATGT
CGCAGGTTCCCGCCGCCCTCGCCCTGACCCACCAGGATGCCACCATGCTC
CTGAGCGCCCAGTCGCACATCGGCGCCAAGAACTGCAACTCGCAGATGGC
CAAGTACGTGCACAAGCGCCGCGCCGATGGTGTCAACATCATCAACTTCG
GCAAGACCTGGGAGAAGCTCGTTCTCGCCGCCCGCGTCATCGCCGCCATC
GACAACCCCGCCGATGTCGTGGCCATCTCGGGCCGCCCCTACGGCCAGCG
CGCCGTGCTCAAGTACGCCAAGTACACTGGCGCCCAGGCCATTGCCGGCC
GCTTCACCCCCGGTAACTTCACCAACTACATCACCCGCAACTACAAGGAG
CCCCGCCTCATCATCGTCACCGACCCCCGCACCGACGCCCAGGCCATCAA
GGAGTCGTCGTACGTCAACATGCCCGTGATCGCCTTCTGCGACACCGACG
CGCCCCTGTCCAACGTCGACATTGCCATCCCCTGCAACACCAAGTCCAAG
AACTCGGTCGGCCTCATGTGGTACCTCCTCGCCCGCGAGGTGCTCCGCAT
CCGCGGTGTCCTCCCCCGCGCCCAGCCCTGGGAGGTCATGGCCGATATGT
TCTTCTTCCGCGACGCCGACGAGGCCGAGAAGGAGGCCGCCGCCGCCGCC
GAGAAGGCCAAGGAGGCCGTCCCCGTCATCACCGCCATGGACGGCGCTGA
GGCCACCAACGAGGAGTGGACCTCGGGCGACGCCGTCGAGGACTGGTCGG
CCCCCGATGCCGCCGAGGCCACCACCGAGGACGCCGACAACTGGGCCTAA
GCTCCCCGTTGTTGCTCCCGCACACCCCCACCCCGTCGTCGTAGCTGGAA
TGATGTGTGCGCCGTGACCCCGGTCGCGACGCGCGCTCTTCCTCCTGCTT
CGGCCTCCCCCGCACGAGCGGATGTCCGCCTGGTCGTGTACTGGCCAGAT
GAATACATGCTCGTGCCTCTTCAATCTCTC