Blastocladiella emersonii clone report

Clone ID BeCSAS2365
Best BLASTX Match ref|NP_001035691.1|
Function Description hypothetical protein LOC617534 [Bos taurus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2365
CCTGCAGTCCGGTCCGGAATTCCCGGGGGACCTAGTGCAATGAAATCATA
GAACACGGAAGATGGGTATCTCGGACTATCTCGCGAAATGCGCCCAGGAC
GGCACGCAGACGGTGAACCTGTCGGACGCGCGAATCAAAAAGTTCCCGGC
CAAGGAGCTCGCGTCGTTCCCGCCCTCGAACATTCGCGCGCTGACCGTCT
CCAACAACAAGCTCACGTCGATCCATGACGCCGACATCACGCAGCTCACG
CGGCTGCAGTCGCTCAACCTGTTCGGCAACAAGCTCAAGGAGCTGCCGCA
GAAGATCAACGAGCTGGCCCTGCTCGAGTTCCTCGTCGCGAGCAACAACC
TGATCAAGGACATTCCGCACGGCTTCGGCTCGTGTCCCAAGCTCCGTGTA
CTCGACCTCAGCATGAACTACCTCCGAGAGCTTCGACCACACATCTGCCG
CTTGTCGACTTTGCGCGAGCTGTACCTCTCGGACAACAAGCTTGGCTCGC
TTCCCGACGAAATCGGCCAGCTCAAGGACCTCACCATCCTCGTTCTGCGC
AACAACCACCTCGAGACGCTGCCCGAGTCGTTCGGCAACCTGACGAGTCT
CGAGAAGCTGCTGATCCAGAACAACCGGTTCAAGTCGCTTCCGCGCTGCC
TCAGCAAGTGCGCCGCACTCTCGACACTCGAGATCTACGGCAACCCGCTG
CACCCGTGCATCGTGGACGCCTACNAGAACGGGATCCAGTAC