Blastocladiella emersonii clone report

Clone ID BeCSAS2363
Best BLASTX Match emb|CAA91982.1|
Function Description Hypothetical protein F47B10.2 [Caenorhabditis elegans]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2363
GCGTCCGCTGCGACACGCGATCGCACCTCCGACTCTCTCTCTGCAACGCA
CCAACGCATCAACCAACCATGCCCTACTCGAAGACCAACCCCAAGATCTT
CCTCCTCGACGGCGAGTCGCTGACTCCCGAGGAGCTCGTCCTGCTCAGCC
ATGGCAACCACACCATCGACCTGACCGAGACCGCCTGGGAGCGCATCGCC
GAGTCGCGCGCGCTCGTCGAGAAGCTCGCGTCGTCGGGCAAGGCCATCTA
CGGCATCAACACGGGCTTCGGCAACTTTGCCACGGTCACCATCCCCGACG
ACCAGCTCTCGCAGCTGCAGATCAACCTCATCACGTCCCACTCGGCGGGT
ACGGGCCCCGCGCTGAGCCCCGCTCGCACCCGCATGTTGCTGGTGCTCCG
CATCAACGTGCTGGCCAAGGGCTTCTCGGGTATCTCGCCCAAGAACGTCG
GCTGCATGCTCGCCGCCTTCAACAAGGGCTGCCTCAGCTACGTCCCCGAG
CAGGGCACGGTCGGCGCGTCGGGCGACCTGGCGCCGCTCGCGCACCTGGC
GCTCGGCATGATGGGCATGGGCAAGATGTGGGACCCGACGCTCAACCAGT
ACGACGAC