Blastocladiella emersonii clone report

Clone ID BeCSAS2361
Best BLASTX Match ref|ZP_00818846.1|
Function Description D-lactate dehydrogenase [Marinobacter aquaeolei VT8]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2361
CGGTCCGGAATCCCGGGTCGACCACGCGTCCGCTAGTCTCCTCAACTCAT
CGCATTCGCTCACTCATCATCACCAATCGCATCACCCCCACCCACCACCA
CCGCCACCATGTCGCCCAACACCGTCGACTCGCTCGCGCCCGCGCCCACG
GTCAGCATGCCCAGCTCGCCCGCCAAGAAGGTGGACGTGACGACGCCGGC
GGGCCTGCAGGCGGTGCTCACCAAGACGCGCCTGTTCGCGCAGCTGTCGG
ACGCGCACCTCGCCCTCCTCGCGGCGGTGGCCGAGCCCATCAAGGTCGGC
AAGGGCACGGTGGTCGTGTCCGAGGGCCAGACGCCGCAGATCTTCGCGAT
CCTGGTCCAGGGCGAGCTGCACGTGCACCAGGCCGGCAAGCACGCGGGCG
CGCTGCACCCGTACGACTCGTTCGGCTTCGGCAACCTGTTTGCCGACTCG
CGCTCGCCCTCGACGCTGCTCGCCGCCGGCGCCGCGTCGTGCTTCCTGGT
CCAGATCTCGCGCGCGCCCTTCCAGGCCCTGCTCGCGCGTGAGCCCACGC
TCGCCCTCGCCCTCCTCCCCGCGCTCGCCGCGCACGTGCCCGACGCGGTC
GCGCCCTCGGTCAAGTCGTCGACGTCGGTCGTGGCGGGCAACGCGGCCAC
CGCGACGACGCCCACGGTCGACGTGCAGCCCAACGGCCTGCCGCGCGACG
CGGCCAACCTCGTGGTCAAGGTGTTCGACAGCAAGCCGTACCAGACCAAG
CTGTTCATTGAGCAGAACGCGCTGCCGGGCTTCGGCTTCAAGCTCGAGTT
CCTCGAGGACAAGCTGTCGCCGGCCACGGTGCACCTCGCCAAGGGCGCGC
ACGCCGTGTGCGTGTTCGTGCACGACTCGGTCAACCCCGAGGTGGCGCAG
GCGCTCGCCGACATGGGCATCGAGATGGTGGCCTACCGGTGCGCCGGCTT
CGACACGTGCCACGTCCCGACGTGCGACAAGCTCGGCATCTCGGTCGCGC
GCGTCCCCGGGTACTCGCCCAACGCGATCGCCGAGCACGCGGCGGCGCTC
ATGATGGCGCTCAACCGCAAGCTCGTGTGGGCGTCGTCGCGCGTCCACAA
CGGCGACTTCTCGCTCGATGGGCTCGTCGGGTTCGACATGAAGGGCAAGA
CGGTCGGCATCATCGGCACGGGCAAGATCGGCGCGTGCCTCGTGTCGATC
ATGCTGGGCTTCGGGTGCCGCGTCATCTGCCAGGACGTGTACAAGAACCC
GGCGCTGCTCGCCAACCCGCAGGTGCAGTACGTGGAGATGGACACGCTGC
TCGCGCAGTCGGACATCATCTCGATCCACGCGCCGCTGCTCCCCGAGACG
CACCACCTCATCAACGAGACGACGCTGGCCAAGATGAAGCGCGGCGTCCT
GATCATCAACACGTCGCGCGGCCCGCTCGTCGACACCAAGGCCCTCATTG
AGGCGCTCAAGTCGGGCCAGGTCGGCGCGTGCGGCCTCGACGTTGTCGAG
GGCGAGAACGACTACTTTTACGAGAACTGCAGCGACTCGGTGGTGACCAA
CGAACAGCTCGCCCATCTCCTCTCGTTCCAGAACGC