Blastocladiella emersonii clone report

Clone ID BeCSAS2360
Best BLASTX Match gb|AAW27038.1|
Function Description SJCHGC07060 protein [Schistosoma japonicum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2360
GTCCGGAATTCTCGGGTCGACCACGCGTCCGGAAAGACTAGCCGCAACCG
CAACCATGTCAAGCGCCATCGAAGCCGGTCCGGCCCCACCACCCCCAAAC
CCCGCCCCGCCTCCCTTCCCCTCACCCCCGCCCACCGCCTCAAGCAGTCC
GTAAACACACGCGCCGCATGTCCGAGTCGCTGAAGCGGTCTCCGATCAAG
GAGCCGCGGTCGAGCACCATCGAGGATCACCCGGCGCCCATCTCGCTGAT
GCTGGACGGGTGCGAGCTCGTCTTCTCGAACGGCGTGTGGACCACGGCGT
CGGCCGACGGCGTGCAGCTGCAGGAGCGGCTCGCCGCGCTGAGCGAGCGC
AACGAGCAGCTGCAGGAGGAGAACCAGATGCTCAAGTTCAAGCTCGAGCT
GCTCATGGACATGCTCGCCGTGTCCAAGCTCGACGTGCTCCGGCTGCAGG
AAGCGCAGCGCCACTAAGTCACGCACGCATTGCACAAAAAAGCTCCATTT
GTATCAC